During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
I believe the answer would be d
Answer:
Overflow incontinence
Explanation:
Overflow incontinence is due to the leakage of small amounts of urine out of a bladder that is perpetually full. Diabetes and spinal cord injuries may trigger this kind of incontinence.
A spinal cord injury may disrupt interactions among the nerves in the spinal cord that regulates bladder and bowel function and the brain, which leads to incontinence.
This type of inconsistency results from Injury to the spinal cord at T10-L2 causing an overactive bladder.
The nurse should obtain the specimen from the catheter.
One of the tests from urinalysis that frequently got contaminated is about infection. The area near the orificium of uretra is near the skin, so there will be microbes around it that can contaminate the sample. The contaminated sample will give a false positive and the result will show the urine are infected.
Taking the specimen from catheter will prevent that contamination, thus giving a better sample.
