1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
11

Match each step of the scientific method with its description.

Biology
1 answer:
Hitman42 [59]3 years ago
8 0

Answer:

Sorry but

Explanation:

You didnt add an image its just the text, sorry

You might be interested in
Answering by analyzing this picture.
Sidana [21]

Answer:

B

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following processes occurs during sexual reproduction?
mamaluj [8]

Answer:

B. An egg cell and a sperm cell unite.

Explanation:

6 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
One human impact on the phosphorus cycle occurs through:
valentina_108 [34]
D is the awnser i think

6 0
3 years ago
Define psychology in ur own words
nydimaria [60]
The study of your brain and mental illnesses and understanding how the brain functions.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Which label belongs in the area marked Y?
    15·1 answer
  • Which organic molecule is responsible for the insulation of internal organs against shock?
    12·2 answers
  • What do all codes, such as Morse code and Braille, have in common?
    9·2 answers
  • Is the ability to identify the bones of the body an inherited trait?
    7·1 answer
  • Living systems are organized in levels according to their structures and functions.
    11·1 answer
  • Need help with the following !
    8·1 answer
  • Differentiate between the amount of initial energy from
    9·1 answer
  • In an energy pyramid, the amount of available energy<br> as you move from the bottom to the top.
    13·1 answer
  • Reptiles depend on energy from what to increase their body temperature.
    12·1 answer
  • What is the complementary DNA strand to TCATACCATTATA ?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!