1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novay_Z [31]
3 years ago
6

Directions:

Biology
1 answer:
solniwko [45]3 years ago
3 0

Answer:

Stomach and Computer? also looks like Guts Or Somthing

You might be interested in
The classic phenotypic ration of 3:1 is the basis of which of Mendel's principles?
Veronika [31]

Answer:

Segregation.

Explanation:

The Mendel had worked on the pea plant and known as as the father of genetics. Mendel had explained the law of genetics that contains law of segregation, law of independent assortment and the concept of dominance.

The law of segregation states that at the time of formation of gametes, each allele may get separate or segregate from the pairs of alleles and unite to form the zygote. This includes the monohybrid cross. The phenotypic ration of monohybrid cross is 3:1 that explains the law of segregation.

Thus, the correct answer is option (A).

6 0
3 years ago
Which of these demands is most closely linked to an increase in the incidence of obesity and diabetes?
Serga [27]
I believe that the answer to this question is A. Demand for cheap, processed food.
5 0
3 years ago
Read 2 more answers
How does a rabbit eating grass show a characteristic of life
Whitepunk [10]

Answer:

It shows the life cycle.

Explanation:

the rabbit eats the grass, a hawk eats the rabbit. the hawk dies and the grass "eats" it.

7 0
3 years ago
Which of the following scientific terms has the most evidence and observations?
OleMash [197]
The answer is b scientific law because it would have had to be tested many times for it to become a scientific law in the first place.
3 0
3 years ago
Read 2 more answers
Rosalind Franklin was instrumental in the discovery of _____.
crimeas [40]

Answer:

The structure of DNA

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • The chart, the organism Rr represents a genetically _____________ individual.
    5·2 answers
  • How can twins be identical?
    9·2 answers
  • There are numerous kinds of shampoo, including vitamin-enriched, fruit-enhanced, color-sensitive, therapeutic, and so on. Shampo
    6·1 answer
  • Elijah wanted to learn more about the growth pattern of bacteria, so he performed the following experiment.
    9·1 answer
  • What happens to water that is not removed from land by evapotranspiration
    15·1 answer
  • How do RNA and ribosomes interact to form protein?
    15·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • PLEASE HELP, WILL MARK BRAINLEST
    14·1 answer
  • Brain liest for whoever can do all ty!
    7·2 answers
  • Embryology concerns the structural changes that occur in an individual from conception through old age. true false
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!