1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
6

Using the following vocab words, write them in order of smallest to largest level

Biology
2 answers:
7nadin3 [17]3 years ago
7 0

Answer:

Cells, Tissues, Organs, Organism

I hope this helps!

Elenna [48]3 years ago
4 0

Answer:

cell, tissue, organ, organism.

Explanation:

You might be interested in
Arrange the organisms according to their position in the food web, starting with the autotrophs
lozanna [386]
1-3-2-4 here it is by birds u mean vulture right
7 0
3 years ago
How might the poison dart frog population suddenly increase? How might this affect the ecosystem?
umka2103 [35]
If the predator that feeds off the dart frogs goes extinct or migrates to a different area then the dart fronts will have a much larger population. This means that the resources the dart frogs rely on will start to deminish and their prey will have smaller numbers
8 0
2 years ago
Read 2 more answers
In dicots, secondary growth
vivado [14]

Answer:

yes

Explanation:

3 0
3 years ago
Which of the following is NOT a negative effect of the way we use science? A. Climate Change B. Damage to the sun C. Pollution D
Kryger [21]

Answer: Option B.

Damage to the sun

Explanation:

Damage to the sun is not a negative way we use science because the sun is very far away from the Earth. The sun is so far away that light from the Sun, traveling at a speed of 186,000 miles (300,000 kilometers) per second, takes about 8 minutes to reach us. This means that The distance from the sun to the Earth is far and it's difficult for science to have negative effects on the sun. The sun is not easily accessible and sun damage is not easily affected compared to pollution, climate Change, overuse of resources which it's as a result of science negative effect.

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • An organism is affected by interactions with which of the following?
    13·2 answers
  • True or false all lipids are solid at room temperature
    15·2 answers
  • Which compound is a reusable, complex protein that speeds up chemical reactions?
    5·2 answers
  • Which of the mechanisms listed below requires energy?
    10·2 answers
  • Is mystery organism living or non living ?
    14·2 answers
  • Sex-linked traits are more common in
    13·2 answers
  • With your partner list three biological processes involving biosynthesis break down what you think your body could carry out usi
    12·1 answer
  • Who is to blame climate change?
    7·1 answer
  • . In the video, two different domains of prokaryotes were discussed. In a six kingdom system, these prokaryotes can also make up
    13·1 answer
  • Some bones develop within sheetlike layers of connective tissue, and they are called ______ bones. Other bones develop from a mo
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!