1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
3 years ago
7

Plant cells have a large membrane-bound space in which water, waste products, and nutrients are stored. This place is known as a

?
Biology
1 answer:
Kisachek [45]3 years ago
7 0

Answer:

Vacuole

Explanation:

You might be interested in
Which of the following statements concerning correlation analysis is not true
LekaFEV [45]

Of the following statements concerning correlation analysis B is not true

it would be B

8 0
3 years ago
Read 2 more answers
The diffusion of water through a semipermeable membrane is a example of ______ and ____
german
B and c are the answers
7 0
2 years ago
Which of the following kingdoms includes organisms that are single-celled eukaryotes that can be either heterotrophic or autotro
skelet666 [1.2K]
Fungi is the correct answer
6 0
3 years ago
How is observation used by scientist to learn new information about the world?
lilavasa [31]

Answer:

observation gives you answers. Patterns, motion, matter, time etc

7 0
3 years ago
An unknown bacterium produces colorless colonies when inoculated onto an emb plate. predict what you would see if you inoculated
just olya [345]

The colourless colonies are only the gram-negative bacterium that will grow as the selective media Eosin Methylene Blue (EMB) followed by mannitol salt agar (MSA), which will only allow one type of microorganism to grow.

Eosin Methylene Blue (EMB) agar is a differential microbiological medium that gives a colour indicator to distinguish between organisms that digest lactose and those that do not while significantly inhibiting the development of Gram-positive bacteria. In laboratories, the selective medium is crucial for differentiating gram-negative microorganisms.

Both EMB (Eosin methylene blue) and Mannitol Salt Agar (MSA) are selective in that they only permit the growth of Gram-negative bacteria.

To learn more about Eosin Methylene Blue (EMB) click here

brainly.com/question/13208125

#SPJ4

3 0
2 years ago
Other questions:
  • Cellular differentiation is responsible for _____?
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the meaning of matter
    14·2 answers
  • If you were to magnify a cell 10,000-fold (typical of the magnification achieved using an electron microscope), how big would it
    5·1 answer
  • Why is the SI measurement system so important to the scientific community
    7·1 answer
  • Which planet does NOT have a moon orbiting it? A) earth B) jupiter C) mercury D) saturn
    6·2 answers
  • Why are nucleic acids important for organism
    8·2 answers
  • Why do you have to check the blood types for donor a recipient for an organ transfer
    12·1 answer
  • You are looking through a microscope at stained cells that appear to have a stiff outer edge and smaller structures inside, incl
    11·1 answer
  • What is the name for the underground layer of permeable rock that contains water
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!