1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
11

Good morning hope you have a good day

Biology
2 answers:
andrey2020 [161]3 years ago
7 0
Thank you u too have a great day
yawa3891 [41]3 years ago
6 0
Thank youuu!! I hope you have a great day as well! :)
You might be interested in
Altruistic behavior a. is that which benefits others while causing a disadvantage to the individual. b. is not a beneficial evol
Maksim231197 [3]

The correct answer is A. Is that which benefits others while causing a disadvantage to the individual.

Explanation:

In biology, altruistic behavior occurs as one organism actions benefit other organisms either because these actions increase the reproductive fitness or the chances an organism survives and prevails over time. Additionally, altruistic behavior implies there is a disadvantage for the organisms acting in the benefit of others. For example, wolves or similar animals take food to those that did not participate in hunting, which means they help other wolves to survive on their own cost as this means less food for those that hunted. According to this, altruistic behavior "is that which benefits others while causing a disadvantage to the individual".

3 0
3 years ago
Which event occurs during
Nonamiya [84]

Answer:

Explanation:

I was doing my research and I'm pretty sure it's "Centromeres divide"

And here is the research I got from the Internet But I may be wrong.

"<u><em>Interphase refers to all stages of the cell cycle other than mitosis. During interphase, cellular organelles double in number, the DNA replicates, and protein synthesis occurs. The chromosomes are not visible and the DNA appears as uncoiled chromatin.</em></u>

6 0
3 years ago
Read 2 more answers
Which of the following is TRUE about the water cycle?
Tresset [83]

Answer:

I, II, III, IV

Explanation:

Evaporation happens when a liquid turns into a gas.

Condensation happens when water vapor turns into a liquid.

Examples of precipitation is rain and snow. Runoff does happen because of precipitation.

Bacteria fixes nitrogen into forms by usable plants. Bacteria is very important to to the water cycle.

8 0
3 years ago
B3.06 In what form:
nikklg [1K]
The answer would be the second one:))))!!!
6 0
3 years ago
Read 2 more answers
Can you tell me what fish this is?
katrin2010 [14]

Answer:

that would be a Jack Crevalle

7 0
3 years ago
Other questions:
  • Use the drop-down menus to determine which structures of the endocrine system are described below.
    7·2 answers
  • if china has a population of 1,355,935,022 people and an area of 3,705,405 mi2 what is the population density of china?
    7·1 answer
  • Which of the following best defines a gene pool?
    9·1 answer
  • How do you calculate the eccentricity of an ellips?
    15·1 answer
  • What kind of tissue is shown in the accompanying images?
    12·1 answer
  • WILL BE MARKED AS BRAINLIEST!!!!
    14·2 answers
  • Four children pull on the same stuffed toy at the same
    6·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • You are at the store with your friend's family and they are looking to buy a new refrigerator for their home. There are two opti
    12·1 answer
  • The data show the number of pieces of mail delivered to a single home address each day for three weeks.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!