1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
9

Can somebody help me out

Biology
2 answers:
Lesechka [4]3 years ago
6 0
The answer is Half for sure
sertanlavr [38]3 years ago
3 0

Answer: HALF

Explanation:

CONTEXT CLUES AND I TOOK IT BEFORE

You might be interested in
Chromosomes are located a) on the genes b) in the cytoplasm c) gametes only d) in the nucleus
Alexxandr [17]
The anwser is D. In the nuclues. Each chromosomes is made of protein and a single molecule is made of deoxyribonucleic acid or DNA.
8 0
3 years ago
Read 2 more answers
What are the features of Inhalation Toxicity?
Naily [24]

Answer:The acute symptoms may be followed by hoarseness, cough, a choking sensation, chest pain and dyspnea. Pulmonary edema is the major lower airway finding associated with chlorine toxicity and clinically can lead to hypoxia and respiratory failure. rapid onset of a burning of the eyes, nose, and throat accompanied by conjunctivitis, corneal burns

Explanation:

3 0
3 years ago
How dna can provide some evidence of evolution?
oksano4ka [1.4K]
With help of the RNA
or comparing two or More species
3 0
3 years ago
Which type of lava flows easily? a) silica-rich b) composite c) basaltic d) smooth
ra1l [238]
Basaltic lava flows easily. Basaltic lava flows erupt primarily from shield volcanoes, scoria and spatter cones, and fissure systems. 
6 0
4 years ago
Read 2 more answers
Explain reproduction as attribute of Living Organism<br>(long answer type question)​
Evgen [1.6K]

Explanation:

Reproduction (or procreation or breeding) is the biological process by which new individual organisms – "offspring" – are produced from their "parents". Reproduction is a fundamental feature of all known life; each individual organism exists as the result of reproduction. There are two forms of reproduction: asexual and sexual.

In asexual reproduction, an organism can reproduce without the involvement of another organism. Asexual reproduction is not limited to single-celled organisms. The cloning of an organism is a form of asexual reproduction. By asexual reproduction, an organism creates a genetically similar or identical copy of itself. The evolution of sexual reproduction is a major puzzle for biologists. The two-fold cost of sexual reproduction is that only 50% of organisms reproduce[1] and organisms only pass on 50% of their genes.[2]

7 0
3 years ago
Other questions:
  • Identify a problem or ask a question
    12·1 answer
  • When the CAU anticodon of a tRNAMet was modified to UAC, the anticodon for tRNAVal, valine aminoacyl-tRNA synthetase, recognized
    8·1 answer
  • Which organism is an example of an organism that is an active filter feeder?
    8·2 answers
  • Why is gene regulation especially important during development?
    11·1 answer
  • swollen lymph nodes can be an indication of a: too much fluid in the body b: too little fluid in the body c: an infection d: no
    5·1 answer
  • What is the definition of ridge
    15·2 answers
  • What type of action does a cardiac muscle tissue preform?*
    10·1 answer
  • Describe the steps that bone goes through as it heals from a break.
    14·1 answer
  • If a claim is mainly supported by anecdotal evidence (stories or claims by people), It is<br> likely
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!