Answer: H2o
Explanation: This chemical energy is stored in carbohydrate molecules, such as sugars, which are synthesized from carbon dioxide and water – hence the name photosynthesis is . In most cases, oxygen is also released as a waste product.
hope helps
Answer:
$ 284 million dollars
Explanation:
If the energy usage of all transportation is 7.10 × 10¹⁴ BTU per year, if their efficiency is to increase by 20%, The new energy usage will be (1 + 20/100)7.10 × 10¹⁴ BTU per year = (1.02)7.10 × 10¹⁴ BTU per year = 7.242 × 10¹⁴ BTU per year.
The energy saved is thus the difference 7.242 × 10¹⁴ BTU per year - 7.10 × 10¹⁴ BTU per year = 0.142 × 10¹⁴ BTU per year.
Since 10⁶ BTU costs $ 20.00, then,
0.142 × 10¹⁴ BTU costs 0.142 × 10¹⁴ BTU × $ 20.00/10⁶ BTU = $ 2.84 × 10⁸ per year = $ 284 million dollars
So the state saves $ 284 million dollars in one year
With the advent of industrialization, several trees have been cut at an alarming rate for raw materials and various other purposes. This felling of trees can be regulated by selective cutting, clear-cutting and shelterwood cutting.
Forest fires are one of the common causes of loss of forests. Sometimes the forest land is set on fire to make the land available for commercial purposes. Once cleared, there can be no vegetation. Natural forest fires are also responsible for the destruction of huge forest covers. Latest fire fighting techniques should be adopted to conserve the forest. However, forest fires are an important part of the ecosystem and it helps replenish nutrients in the soil from dead and decaying matter.
More trees should be planted to increase the forest cover. Trees should be selected according to the geographical conditions of a particular region and proper care should be taken during the growth of trees.
Prevention of exploitation of forestry and forest products is necessary for the conservation of forest.
The existing forests should be protected from diseases by spraying chemicals, antibiotics or development of pest-resistant strains of trees.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
