1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
4 years ago
7

Look at the slide from an oral presentation about fossils. A slide that reads, "Fossils: How they help us understand the past."

There is a photo of a fossil. What should be added to this slide to make it more effective? an audio track an instructions list the speaker’s notes a caption
Biology
2 answers:
vredina [299]4 years ago
7 0

Answer:A,B,D

Explanation:

Morgarella [4.7K]4 years ago
3 0

a caption

Explanation:

In a presentation slide, pictures should carry appropriate captions that describes them.

A good picture caption makes presentation very effective and easy to relate with.

  • A good caption is one that give information about the picture it is capping.
  • The source of the picture in use should also be shown at the reference section.
  • The picture must relate with the context of the presentation.

Learn more:

Presentation brainly.com/question/7874371

#learnwithBrainly

You might be interested in
MARKING PEOPLE AS BRAINLIST ⚠️⚠️⚠️<br><br> Give three pros and cons of fire suppression
IrinaK [193]
Cons:
It kills animals
It destroys land and trees
It ruins animals homes

Pros
It clears up lane so we can build
Some rare animals need fire to reduce overhanging plants to live ( it’s called a karner blue Caterpillar btw)
And fire is a natural phenomenon that nature has evolved with
4 0
3 years ago
A patient is taking bismuth subsalicylate [pepto-bismol] to prevent diarrhea. the nurse performing an assessment notes that the
statuscvo [17]
The nurse should assure the patient that black tongue is an expected side effect of taking that particular drug. The active ingredient in the drug contain bismuth. The tongue and the alimentary canal of humans contain trace amount of sulphur, when bismuth comes in contact with this sulphur, bismuth-sulphide will be formed. Bismuth-sulphide is an harmless by product, thus, the tongue discoloration observed in the patient is harmless.<span />
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is the term used to describe the number of individuals moving into a population?
Minchanka [31]
The term used to describe the number of individuals moving into a population is Immigration.
8 0
3 years ago
Read 2 more answers
In order for this code to represent a piece of DNA, which base must be replaced by thymine?
HACTEHA [7]
I guess you forgot to add the picture or so.
Based on the Complementarity of the 4 nucleotides, The thymine must always be placed in  front of the Adenine, and the Cytosine must always be placed in front of the Guanine.
Any change in this rule causes the deformation of the DNA, and can sometimes cause fatal diseases like the melanoma (skin cancer) etc...

Hope this Helps! :)
7 0
4 years ago
Other questions:
  • Which event is likely to trigger succession
    8·1 answer
  • Which best describes John Greenleaf Whittier's purpose in "The Fish I Didn't Catch"?
    10·1 answer
  • Fats do not dissolve in water. What name is given to this property of fats?
    5·1 answer
  • An insect looks like a leaf, so it blends in with its surroundings and is hard for predators to see. The insect’s characteristic
    7·2 answers
  • What happens when sodium potassium pump stops working?
    14·1 answer
  • please help quickly! very easy question, i just want to check my answer! Y = yellow leaves y = green leaves S = smooth seeds s =
    15·1 answer
  • Which of the following scientists DID NOT disprove spontaneous generation? *
    9·1 answer
  • In Drosophila melanogaster the recessive alleles for brown and scarlet eyes (of two independent genes) produce a novel phenotype
    12·1 answer
  • What is the purpose of genetically modified crops?
    13·1 answer
  • What is the elevation of hachure line A?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!