1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
15

Does mass or velocity have a greater effect on kinetic energy? Why?

Biology
1 answer:
igor_vitrenko [27]3 years ago
5 0

Answer:

Yes, they have.

Explanation:

As kinetic energy is proportional to the velocity squared, the velocity increasing has a greater effect on the translational kinetic energy. If the mass is doubled the kinetic energy of the object will double as well, and doubling the velocity of the object will quadruple its velocity.

You might be interested in
A theory of evolution that states that a species evolves in spurts of rapid change and then goes through periods of no change is
aleksklad [387]
<span>punctuated equilibrium.

</span>
8 0
3 years ago
Read 2 more answers
I NEED HELP BAD..... Energy from the sun comes from nuclear fusion. What happens during that reaction?
fomenos

The Sun is a main-sequence star, and thus generates its energy by nuclear fusion of hydrogen nuclei into helium. In its core, the Sun fuses 620 million metric tons of hydrogen each second. The nuclear binding energy curve.


I hope this helps


4 0
4 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
The double fortification process involves adding which nutrient(s) to salt ?
densk [106]
The double fortification process involves adding iodine and iron to salt. It is a method used to fight micronutrient deficiencies in developing countries. Iron and iodine are two of the most important micronutrients involved in cognitive function, maternal and infant survival and human productivity. This is a cost-effective method that ensures that the population receives these nutrients without having to change their eating habits. 
4 0
3 years ago
Read 2 more answers
Where does all of the energy needed by living things originally come from
o-na [289]

It is needed by all living things and every living cell to carry out life processes, such as breaking down and building up molecules, and transporting many molecules across cell membranes. The form of energy that living things need for these processes is chemical energy, and it comes from food.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Evaporation is the stage of the water cycle in which liquid water becomes water vapor. On which of the following days would the
    13·1 answer
  • A ______ is the segment of DNA that codes for a trait. (protein)
    11·1 answer
  • Can someone help me with this
    8·1 answer
  • Please answer my question. I would mark it as a brainlist answer if it helps me.
    14·1 answer
  • 2. Any organism that has a true nucleus is in the domain:
    12·1 answer
  • First-division nondisjunction will only yield gametes with an extra chromosome. True or False
    11·1 answer
  • A friend claims her pet ferret is descended from the wild polecat. You want to learn more about this ferret ancestor. An online
    8·1 answer
  • Nondisjunction that occurs during meiosis II produces what?
    6·1 answer
  • A national park is home to large populations of mountain lions, deer, rabbits, and grass. Recently, park rangers decided to intr
    14·1 answer
  • Why cell known as structural and functional unit of life.​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!