1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
artcher [175]
3 years ago
10

Pls help.. i will mark brainliest for best answer

Biology
2 answers:
Alchen [17]3 years ago
6 0

Answer:

A large amount of heat and pressure

Ira Lisetskai [31]3 years ago
3 0

Answer:

B

Explanation:

Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids or, more commonly, some combination of these factors. Conditions like these are found deep within the Earth or where tectonic plates meet. I got it from Googole :P

You might be interested in
How would a population decrease in primary consumers affect the ecosystem?
kicyunya [14]
A population decrease in primary producers would affect the ecosystem negatively because everyone who ate the primary consumers would have a lack of food.
3 0
3 years ago
The question is which ecosystem would be more likely to survive if a disease killed the grasses
ivanzaharov [21]

Answer:

I believe the answer is 3

Explanation:

4 0
3 years ago
Problems in using common names to universally identify living things include:
babunello [35]

Answer:

The correct answer will be options-

1. Foreign names may not be understood

2. Many names may exist for the same organism

3. Many names may exist for the same organism

Explanation:

The accepted system of nomenclature called binomial nomenclature was developed by the Bauhin in the 16th century but was improved and widely used by Carolus Linnaeus in his findings.

The binomial nomenclature of the system was developed to overcome the problems caused by the vernacular system of naming organisms like:

1. more than one name can exist for a single organism.

2. common names are not based on traits.

3. Common names may not be understood by other people.

Thus, the selected options are correct.

3 0
3 years ago
which group first suggested that gray wolves be reintroduced to yellowstone? environmentalists who knew little about the parks o
sdas [7]
The answer is biologist.
6 0
3 years ago
Read 2 more answers
Describe evidence from the Gulf Stream article and the Currents Tank Investigation
Marysya12 [62]

Answer:

This strong current of warm water influences the climate of the east coast of Florida, keeping temperatures there warmer in the winter and cooler in the summer than the other southeastern states. Since the Gulf Stream also extends toward Europe, it warms western European countries as well.

Explanation:

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • HELP PLEASE NOW I GOT TUTORING AT 6:00 PLEASE HELP!!!!! THIS IS URGENT
    6·1 answer
  • What is is a potent stimulus for producing pure hypovolemia, but not osmometric thirst?
    8·1 answer
  • The evolutionary history for a group of species is called a
    15·1 answer
  • Which of the following is a correct difference between active transport and facilitated diffusion?
    15·1 answer
  • What does the fossil record tell us
    10·1 answer
  • What degrees is the tilt of the earth
    13·1 answer
  • Please help no links or ill report you
    11·1 answer
  • How does frshwater ecosystems help with flood conrol
    12·1 answer
  • Vance has just learned some new material for an electrical engineering class he is taking. Based on memory research, what is the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!