Answer:
the answer is B, the location of the bird feeders
No it cannot change because if anatomy chage then the person will be dead
B cells mature in the bone marrow or in the lymph node. Hope I could help!
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
This was a hard one but I did some research and I found this
Our genome has 3 billion base pairs so a naive calculation shows 3x10^36 different combinations. But that's a meaningless number. A lot of those variants would be silent mutations, i.e. changes in introns, repeated sequences, 3rd position codons, etc etc that would have no effect on the phenotype.
Hope this help
