1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liraira [26]
2 years ago
5

What si the answer ? Somebody pls smart peopdn

Biology
1 answer:
Liula [17]2 years ago
3 0
I got sweat in my eyes
Lost a bet and got bit by a hundred flies
I fell out a big ol' tree
Hit every branch and scraped up both my knees

I got chased by dogs
Licked by a frog
Got a rash on my legs
Dropped a dozen eggs

I got splinters in seven of ten
And tomorrow, I'll do it all again
You might be interested in
Tell me something about ur life
Anna007 [38]

my name is Oladeji emmanuel I hail from Oyo state Nigeria

6 0
3 years ago
Read 2 more answers
How would producers that carry out chemosynthesis differ from photosynthetic producers is it possible food source
alexandr1967 [171]

2 to drddfdeee shark week say hey to ask so we so so will ask week

3 0
3 years ago
19. Identify the appropriate mixed number for the picture
irga5000 [103]

Answer:

C

Explanation:

you have 1 full square and 1/4 of the other square, making 1 1/4

3 0
3 years ago
Do dogs hate cats or do cats hate dogs?
Citrus2011 [14]

Answer:

I like dogs but cats hate dogs

5 0
3 years ago
Which process is governed by the autonomic nervous system?.
ankoles [38]

Answer:

<em>Involuntary </em><em>physiologic</em><em> </em><em>processes</em>

3 0
3 years ago
Other questions:
  • Sugar is dissolved in water.What is the solute?
    8·1 answer
  • Due to the pumping action of the electron transport chain, protons have a high concentration in the _____ and a low concentratio
    8·1 answer
  • Scientists have been experimenting with gene therapy which often involves the use of bacteria or viruses to deliver new or modif
    14·1 answer
  • Commercial printing uses an area of patterned dots called a ________. the dots vary in size depending on the level of color need
    11·2 answers
  • Oxycontin abusers are typically young white males. <br> a. True <br> b. False
    9·1 answer
  • Approximately how much time passes between H and B?
    13·2 answers
  • What is th advantage of this type of reproduction in paramecium?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Faults are
    14·2 answers
  • Scientists take scientific measurements carefully in order to ensure their reliability and validity. What is the difference betw
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!