1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
riadik2000 [5.3K]
3 years ago
7

The breakdown of _______ in the Mitochondria provides the energy to add phosphate onto ADP to make ATP

Biology
1 answer:
alex41 [277]3 years ago
3 0
Does it have any answers?

You might be interested in
Which of the following would be one way a farmer could increase the amount of available nitrogen in his fields without adding a
katovenus [111]

The correct answer is:

Grow a legume crop to support the development of root nodule

The best way that a farmer could increase the amount of nitrogen in his fields without adding synthetic fertilizer is to grow a legume crop to support the development of root nodules. This is because legumes have a symbiotic relationship with bacteria found in the soil. 

Explanation:

Legumes use nitrogen fixing bacteria, specifically symbiotic rhizobia bacteria, within their root nodules to counter the limitation.The plant root cells convert sugar into organic acids which then supply to the rhizobia in exchange, hence a symbiotic relationship between rhizobia and the legumes.

4 0
3 years ago
Read 2 more answers
Which organ helps to process essential proteins and minerals, so that they can then be taken through the bloodstream and to the
Kaylis [27]
Im pretty sure that'd be "the stomach"
4 0
3 years ago
Read 2 more answers
__________is the most important condition for fossilization.
sesenic [268]
Wood tissue (witch in more detailed stans for shell, bone, and teeth)
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is a mineral that breaks in repeatable, predictable patterns is said to have this property?
olasank [31]

Pretty sure it's E, Cleavage

6 0
3 years ago
Read 2 more answers
Other questions:
  • Using at least three sentences, explain the cycling of energy through the processes of photosynthesis and cellular respiration.
    12·1 answer
  • The structures that project from the cell membrane
    9·1 answer
  • What is the difference between monogenic & polygenic inheritance?
    5·1 answer
  • In general, locomotion on land will require more energy than locomotion in water. By integrating what you learned about animal f
    9·2 answers
  • The largest biome is the
    12·2 answers
  • Please help in biology.
    9·1 answer
  • Please Help
    6·1 answer
  • What is the most significant difference between animal and plant cells? Why do you think that?
    8·1 answer
  • Can you use volume alone to predict whether an object will sink or float? Explain.
    6·2 answers
  • Some people argue that evolution, which is generally associated with progressive increases in the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!