1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
9

Please help, thanks!

Biology
1 answer:
Westkost [7]3 years ago
3 0
The answer to your question is both C
You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which statement accurately describes the role of key organelles in energy transfer?
miss Akunina [59]

Answer:

Energy is captured and stored in the mitochondria and released in the chloroplast.

Explanation:

SORRY I THINK

7 0
3 years ago
Read 2 more answers
What is it called when rain or snowmelt seeps through soil or rock down into the aquifer?
Cloud [144]

Answer:

Groundwater

Explanation:

4 0
3 years ago
Are all flatworms hermaphrodites?<br>​
Elden [556K]

Answer:

They are.

Explanation:

Looked it up.

4 0
3 years ago
Cerumen is produced by glands located in the
borishaifa [10]
Stratum corneum is the answer
4 0
3 years ago
Other questions:
  • Dna makes up chromosomes which are located in what part of the cell
    8·1 answer
  • The skin condition caused by hyposecretion of the oil glands and is an inherited condition is known as
    5·1 answer
  • A nurse in a mental health clinic is caring for a client who has bipolar disorder
    12·1 answer
  • What would most likely happen to the bear population if the salmon population increased?
    15·1 answer
  • Animals in the same phylum may have different nervous system structures. For example, octopuses have large, complex brains while
    5·2 answers
  • What is one thing that earthquakes, volcanoes, and tsunamis have in common
    11·1 answer
  • Hair occur in all mammal except those of rodentia , chiroptera , primata , cetacea​
    12·2 answers
  • Give three examples of ways in which biology can help<br> inform everyday decisions.
    14·1 answer
  • In which phase of mitosis do the chromosomes wind up and become shorter and thicker? I think its prophase??
    12·1 answer
  • The mitochondrial matrix has what charge compared with the intermembrane space?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!