1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
2 years ago
7

14

Biology
1 answer:
strojnjashka [21]2 years ago
7 0
Changing the amount of solar energy
You might be interested in
Which of the following describes how the pollen must travel in order for pollination to occur?
Doss [256]

Answer:

the answer is C

Explanation:

another word for stamen is anther and i took the K12 test

hope you do great

5 0
3 years ago
While studying the function of a G protein-coupled receptor you develop a modified GTP molecule that has the same binding capabi
laila [671]

<u>Answer:</u>

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.

<u>Explanation:</u>

Background Knowledge:

GPCR (G Protien coupled receptors) are present inside plasma membrane in huge amount. As name suggest that these receptors are coupled with G proteins during their inactive state present inside of the cell. During their Inactive state these G proteins are bounded with GDP molecule.

Upon receiving signal molecules from outside of cell alters the shape of GPCR. These receptors also triggers change in G Protein, as a result of this GTP get attached with them. This protein further activates reaction cascades inside of the cell.

What happen if GTP cannot be hydrolyzed to GDP + Pi?

If GTP cannot hydrolyzed in to GDP + Pi than, it cannot be able to dissociate from G proteins. Cascade system doesn't stop and produces many effects on body.

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.
7 0
3 years ago
Ergogenic aids can be useful in some circumstances, some are possibly useful but still under study, and still others are downrig
Jet001 [13]

Answer:

Using beta-hydroxy-beta methylbutyric acid (HMB) can improve performance for those who perform explosive repetitions of activity, such as running or lifting weights. Consuming small amounts of caffeine can increase mint alertness. C. The consumption of branched-chain amino acids and creatine can improve muscle recovery after intense physical activity. D. An ergogenic aid that increases muscle mass but can also cause uncontrolled growth of the heart or other organs and is prohibited by the International Olympic Committee: anabolic steroids.

Explanation:

In the answer I leave you the text with the blanks completed ... It is also important that you know that amino acids are important for the formation of muscle mass and its recovery, in addition to creatinine.

On the other hand, these supplements are administered in people who have high performance in sports, and accompanied by a good diet and specific diet, otherwise they will not work.

Anabolics are chemical structures that promote energy reserves and anabolism for muscle tissue hypertrophy, but they do not have a selective effect on the skeletal muscle, but rather affect other parts of the body, that is why they are risky, cause heart failure, cardiovascular, liver, kidney, and even possible alterations of the gallbladder.

5 0
3 years ago
Suppose that the plasma membrane around a eukaryotic flagellum is opened to reveal the axoneme inside. the radial spokes connect
mash [69]

The flagella of the eukaryotes is composed of the doublet microtubules. The central bundle of these microtubules is known as the anoxeme. In an axoneme, a single pair of the singlet micortubules is surrounded by the nine doublet microtubules. When the plasma membrane of the flagellum is opened to expose the axoneme, and the radial spokes are broken, it will lead to the elongation of the axoneme,

8 0
2 years ago
Parents arrive to the clinic with their 5-year-old child and inform the nurse the child has just been diagnosed with sickle cell
nadezda [96]
The parents should go to gene counciling to determine who carried the gene that was passed down to the offspring.
4 0
2 years ago
Other questions:
  • What factor may influence enzyme activity?
    5·1 answer
  • In gorillas, the ability to roll the tongue is under the control of 1 gene. The R allele, which confers tongue-rolling ability,
    11·1 answer
  • What parts of the human body might become vestigial in the next million years?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Determine whether the statements about DNA are true or false.
    8·1 answer
  • This is a picture of cattle rearing. What do you want to know?
    11·1 answer
  • The big bang theory has finally answered one of the biggest questions of science—the origin of the universe is it true or false?
    15·2 answers
  • What do scientists on the Intergovernmental Panel on Climate Change (IPCC) predict will happen to the earth's average temperatur
    13·1 answer
  • 8. Analysis of a basalt rock sample shows that 12.5% of its radioactive potassium-40 remain undecayed.
    8·1 answer
  • 2. Which of the following statements is true about agricultural productivity in the United States since 1948?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!