1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
12

If all cells have the same DNA how do they become different types of cells?​

Biology
1 answer:
beks73 [17]3 years ago
5 0
Cells are made of the same DNA but they can have different functions. It depends on where they are in your body; each of them have a separate job. There are different types of cells. Apparently, for a cell to work...1000 proteins must be made.
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
During which phase do the chromosomes make copies of themselves so that there are two of each one?
SashulF [63]

Answer:

The beginning and majority of the time is known as Interphase. Interphase is 80% of the total cycle and is where the cell does most of the work in replicating organelles, chromosomes, and preparing to undergo Mitosis which is the actual splitting process where one cell becomes two. During Interphase there are 3 major steps, G1, S, and the G2 phase.

Explanation:

4 0
3 years ago
Scientists can study the human genome using DNA fingerprinting.
Naya [18.7K]

Answer:

your answer is C.

Explanation:

5 0
2 years ago
Most food chains have no more than six organisms. why is there a limit to the number of links in a food chain?
hammer [34]
The answer is B.)  animals at the end of the food chain would not get enough food to stay alive.
3 0
3 years ago
Electrical devices that has sound energy as an output
Margaret [11]
<h2>Answer with Explanation </h2>

The speaker and transformer are the devices that consume the electrical energy and release the sound as an output in this process the phenomena which are acquired is electromagnetic induction. The sound energy can also be converted into the electrical energy but fir this process high temperature and high frequency is required. The sound energy is important as it informs us about the character, place and time.

8 0
3 years ago
Other questions:
  • Which process requires the sperm and egg cell
    9·1 answer
  • Why will discharge of sewage wastes into lakes and rivers having abundant varieties of fish eventually eliminate much of the div
    6·1 answer
  • Please answer it's 10 points
    5·1 answer
  • Bacteria such as
    9·1 answer
  • Seasonal changes bring about scenes like this one. Plant cells respond to changes in _________________ and as a result, photosyn
    12·1 answer
  • Which reaction is most likely catabolic?
    9·1 answer
  • Infer what effect expanding a crop’s growing season would have on the world’s food supplies.
    14·1 answer
  • An example of a food chain where pillbugs play a part.
    7·1 answer
  • Differentiate between macro and micro farm animals ​
    8·1 answer
  • Which question could be tested in a scientific manner?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!