Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
This was Lamarck's idea. Here's an example: Suppose giraffes originally had short necks that they stretched to reach high-up leaves in the trees. This continuous stretching of the neck was passed onto offspring, who as a result had slightly longer necks. This continued for multiple generations until we get today's long-necked giraffe. Lamarck was on to something (that something being evolution by natural selection, which Darwin discovered), but his theory wasn't completely correct since organisms can only pass on genes (segments of DNA that code for a characteristic or function) to their offspring. Since "stretching" would not code into DNA, it wouldn't be passed onto offspring, proving Lamarck's theory incorrect.
Answer: the major function of mucus is to protect the lung through mucociliary clearance against foreign and chemicals entering the lung.
Explanation:
