1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olya-2409 [2.1K]
3 years ago
5

According to the left

Biology
1 answer:
Blizzard [7]3 years ago
6 0
Music yes because the left is more analytical and logical the right is more fun and talented
You might be interested in
How does a noncompetitive inhibitor decrease the rate of an enzyme reaction?
Wittaler [7]

Answer :B. By changing the shape of the enzyme's active site.

check the attachment

Explanation: This is a type of inhibition , in which a molecule binds to another part of the enzyme instead of the  active site.

On binding, it disrupts the  normal hydrogen bond and hydrophobic   interactions holding the enzyme molecule in its three dimensional shape, therefore distorting the conformation and   ACTIVE SITE of the  enzyme (changed it shape).

Since the active site is the precise location enzyme must bind with substrates for enzymatic reactions,this makes the enzyme not fit  for binding with the substrate, therefore  the efficiency  is reduced. No substrate-enzyme complex, and hence no substrate-product  complex for the release of  products, this brings down the turnover rate and eventually

<u>the rate of reaction of the enzyme</u>

Thus, the enzyme function is totally blocked, even in high concentration of the substrate,

Download docx
4 0
2 years ago
Jason and Lyric both are trying to enter Harmony House. Jason pushes on the door with a force of 5N right and Lyric pushes on th
goblinko [34]

the total number of pushes all together will be <u>8</u><u>N</u>

4 0
3 years ago
BRAINLIESTTT ASAP!!!
earnstyle [38]
They have the same mass as the mass of the reactants. evidence to back this up is the law of conservation of mass


6 0
3 years ago
Read 2 more answers
Which of the following is NOT an accurate justification for studying microbes?
Burka [1]
The answer would be B, because they have subcellular organelles.
5 0
3 years ago
True or false: surveillance can be performed through either stationary or mobile means.
Ivanshal [37]
<span>This is true. Surveillance can be performed efficiently through both stationary and mobile means. As far as human surveillance goes, people can track other people by tailing them or by using a stationary means such as a stake out. As far as technology goes, there are plenty of mobile devices that can be used for surveillance such as tracking devices. Security cameras can be used for stationary purposes.</span>
6 0
3 years ago
Other questions:
  • Explain why a phenotype might not always indicate genotype
    13·2 answers
  • Deposits of natural gas are most numerous in ________.
    15·1 answer
  • As engineers prepare to build a hydroelectric dam, to which factor should they pay special attention
    12·2 answers
  • Cell differentiation occurred between which two stages?
    13·1 answer
  • A population of lab rats recently escaped into the sewer system of Washington, D.C. A brave researcher sampled this population a
    9·1 answer
  • Sexually transmitted infections can be passed through which type(s of contact? kine 198
    15·1 answer
  • Specialized cells called _____ help an animal to detect stimuli
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The graph represents changes to two jackrabbit populations in two different areas over 15 years.
    12·1 answer
  • 3. Why are some traits seen more in populations than others?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!