All categories

2 years ago

100 points I need help please will give brainliest :(

Biology

2 answers:

inessss [21]2 years ago

6 0

Sheeshhhh what he said ^

Licemer1 [7]2 years ago

4 0

Answer: One of the most common Monera is Escherichia coli, also known as E. coli. "[E. coli] is a Gram-negative, facultative anaerobic, rod-shaped, coliform bacterium of the genus Escherichia that is commonly found in the lower intestine of warm-blooded organisms." States wikipedia.* Signs of E. coli are stomach pains and cramps, diarrhea that may range from watery to bloody, fatigue, loss of appetite or nausea, vomiting, and low fever < 101 °F/ 38.5 °C (not all people have this specific symptom).

E. coli comes from human and animal wastes. During precipitation, E. coli may be washed into creeks, rivers, streams, lakes, or groundwater. Another way to get it is from contaminated food, a lot like corona virus. When cattle are slaughtered and processed, E. coli bacteria in their intestines can get on the meat. And when ground beef is made, it combines meat from many different animals, increasing the risk of contamination.

Explanation:

You might be interested in

Choose a mammal in each group, monotreme, placental mammal, and marsupials. Write a paragraph description of each mammal and inc

MrRa [10]

Answer:

a primitive mammal that lays large yolky eggs and has a common opening for the urogenital and digestive systems. Monotremes are now restricted to Australia and New Guinea, and comprise the platypus and the echidnas.

Explanation:

7 0

3 years ago

Gravitational potential energy is related to?

Archy [21]

What an object is made of

5 0

3 years ago

What are the causes of muscle fatigue? check all that apply.

Pie

Answer:

While exercise is a common cause of muscle fatigue, this symptom can be the result of other health conditions, too.

Causes of muscle fatigue

Addison's disease.

age.

anaerobic infections.

anemia.

anxiety.

botulism.

cerebral palsy.

chemotherapy.

8 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

2 things that can cause a cell to lose its ability to regulate its cell cycle properly

Sveta_85 [38]

Answer:

Cancer is unchecked cell growth. Mutations in genes can cause cancer by accelerating cell division rates or inhibiting normal controls on the system, such as cell cycle arrest or programmed cell death. As a mass of cancerous cells grows, it can develop into a tumor. hope this helps

Explanation:

3 0

3 years ago