1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
6

If you allowed your dilution tubes to incubate for 24 hours before plating them on the TSA agar plates, do you think the results

of the experiment would be impacted? Assume that unlimited resources are present in the tubes. Explain your answer.
Biology
1 answer:
Andreyy893 years ago
5 0

Answer:

The TSA or the tryptic soy agar is formed of casein and soybean meal, this formation helps in the appropriate growth of a huge array of non-fastidious and fastidious microbes. This combination of soy and casein provides organic nitrogen in the form of polypeptides and amino acids, which makes the medium more suitable for growth.  

In the given case, if one permits the incubation of the dilution tubes for 24 hours prior to plating them on the TSA agar plates than there is a more probability of the result to get affected. As if unlimited resources are already present in the tubes, it will provide more favorable conditions for the formation of more colonies and thus will influence or change the colony-forming units per milliliter.  

Even if the dilution is performed in a hood and in an autoclaved medium then also there will be an increase in the colonies of the microbes as in the time of 24 hours interval more microbes will get differentiated and will increase in number.  

You might be interested in
Help me with my biology question please please
jarptica [38.1K]
What is the question??
5 0
2 years ago
Which statements describe a situation with a displacement of zero
MA_775_DIABLO [31]

An object that starts and ends at the same point would have zero displacements.

<h3>What is displacement?</h3>

Displacement is the property of a body or an object to be moved from one place to another.

Thus a body that moves or is moved from point A to point B has been displaced.

A body with zero displacements either did not move at all or finished at the same point it started.

For example, a body that moves from point A to B, and then back to A will have zero displacements.

More on displacement can be found here: brainly.com/question/11934397

#SPJ1

5 0
1 year ago
4. What three factors contribute to natural selection? a.Static environment b.Variation of genes c.Overproduction of offspring d
Sophie [7]

Answer:

i think b and c. but not sure what the third is? only 70% sure.

Explanation:

8 0
3 years ago
Read 2 more answers
Many molecules are moved through the body by
Solnce55 [7]

Question: Many molecules are moved through the body by?

Answer:<u> The molecules are moved through the body by uses special transport proteins to move molecules across the membrane that cannot pass thorough on their own. Usually large molecules. Carrier proteins blind and carry the molecules across the cell membrane. They provide an open channel of passageway through the cell membrane for molecules to move across.</u>

<em>Hope this helps!.</em>

<em>~~~~~~~~~~~~~~~~</em>

<em>~A.W~ZoomZoom44</em>

6 0
3 years ago
Energy from the sun is transferred to the earth by
Scilla [17]

Answer: radiation i think

8 0
2 years ago
Other questions:
  • A heat wave that causes an organism to move to a cooler climate is an example of ?
    13·2 answers
  • A cell is classified as eukaryotic if the cell
    7·1 answer
  • PLEASE HELP 15 POINTS AND A BRAINLY TO RIGHT ANSWER!
    14·2 answers
  • How do animal-like protists differ from plant-like protists?
    13·1 answer
  • What plate does New York lie on
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Are hydrangeas Monocots or Dicots?
    14·2 answers
  • What are the possible phenotypes of chicken offspring if one parent has black feathers ( FB ) and one parent has white feathers
    15·1 answer
  • A trait which shows up in nearly equal frequency in males and females, such as eye color, is called a(n) __________________ trai
    5·1 answer
  • 234 x 234
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!