1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
15

I was thinking B or C but i need another opinion​

Biology
1 answer:
son4ous [18]3 years ago
3 0

Answer:

Option C

Explanation:

Option C makes the most sense because it is true.

I hope it helps!!!

You might be interested in
Need all the answers will give 5 stars.
bulgar [2K]

Answer:

1. "a, O, and J"

2. "R and C"

3. I'm not entirely sure about #3, but I believe the answer is "d and R"

4."J, K, I, M, N"

5. "d"

6. "I" explain why: "It is at the bottom, so it is therefore the oldest."

7. "Q" explain why: "It is at the top, so it is therefore the youngest."

8. The folding occured before the faulting. Why? Because the folding is evident in the second half of the fault.

<u><em>DISCLAIMER: any of these answers could be wrong. I did my best but I am still human.</em></u>

7 0
3 years ago
Plants, such as sunflowers, contain specialized receptor cells that respond to light and grow in the direction of a light source
loris [4]
Photoreceptor proteins are light-sensitive proteins involved in the sensing and response to light in a variety of organisms. Some examples are rhodopsin in the photoreceptor cells of the vertebrate retina,phytochrome in plants, and bacteriorhodopsin<span> and bacteriophytochromes in some bacteria.


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
5 0
3 years ago
What information would be most relevant to determining the time of death?
Nuetrik [128]

Lividity can be defined as the typical bluish-purple discoloration of the skin after death. Rigor mortis can be defined as the postmortem state in which the muscles become stiff.

  • After death, the stomach contains identifiable ingested foods within two hours.

  • Rigor mortis is characterized by the stiffening of the body after death, which is caused by the absence of ATP in muscle tissues.

  • Postmortem lividity or livor mortis is caused by the accumulation of blood in blood vessels (the lack of arterial pressure) as a result of gravity.

  • The most relevant information to determine the time of death is the presence of lividity, rigor mortis, and/or stomach contents (Option c).

Learn more in:

brainly.com/question/2053340?referrer=searchResults

5 0
3 years ago
Suppose you are an astronomer, and a child asks you to explain how long it takes light to travel through space. In your own word
Aleonysh [2.5K]
Ok so I would start by saying that light has a maximum speed, then explain that because space is so big we measure it's distance in light years and which means how light travels in a year at 186,282 miles per second Put that in perspective my saying If you could travel at the speed of light, you could go around the Earth 7.5 times in one second. Tell them Sunlight takes about 8 minutes 19 seconds to reach the Earth and that it can take millions or more light years for more distance stars light to reach our telescopes .
6 0
3 years ago
Do unicellular organisms (such as bacteria) have an internal environment that they maintain through homeostasis? Why or why not?
svp [43]

Answer:

This is the answer of your question.

7 0
3 years ago
Other questions:
  • The diagram shows a plant cell with a large central vacuole. What would happen to this plant cell if the central vacuole was rem
    7·1 answer
  • What is the course concept that refers to how someone uses their tongue, palate, teeth, jaw movement, and lips to shape vocalize
    6·1 answer
  • Which phrase describes one characteristic of radioactive elements
    7·2 answers
  • 1 2 3 will give brainliest for all three being right
    8·1 answer
  • T is a trait for tallness in pea plants. The trait for shortness is t . In a case of simple dominance, what is the height of a p
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Under capitalism, the allocation of goods and services is determined by ________________________________.
    7·2 answers
  • Look at your data. With three foods, Flock
    6·1 answer
  • Which body wave has the largest amplitude and thus is the most destructive?
    6·1 answer
  • Which of the following are CHARACTERISTICS of living things?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!