1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
loris [4]
3 years ago
7

Which of the following statements is true about the DNA inside your cells?

Biology
1 answer:
vova2212 [387]3 years ago
4 0

Answer:

where is your statement

You might be interested in
Which part of cell theory is the diagram to the right
navik [9.2K]
This is mitosis: the cell does steps before it splits in two
G1 - synthesis - G2 - M(mitosis) in mitosis is PMAT
Prophase
Metaphase
Anaphase
Telophase
Then the last step is cell division or what its called is cytokinesis
5 0
3 years ago
Suppose a dominant allele (N) codes for a big nose and a recessive allele (n) codes for a small nose. Imagine that an organism r
Marta_Voda [28]

A. The organism has a large nose, because it's homozygous.


6 0
3 years ago
Who discovered that dna was the genetic material or transforming factor that could convert nonvirulent r-type streptococcus pneu
KatRina [158]
Discovery
               In 1928 it was discovered by Frederick Griffith in an experiment generally known as transformation.

Experiment
                 
 In his experiment he considered two strains of <em>streptococus pneumonia,</em> one was R-type which was non-virulent and cause no disease in mice, other was virulent and S-type which cause disease and at last death of mice.
This experiment was comprised of four steps which are as follow:

 Step 1:
           First he injected living strain of S into mice, after sometime mouce died.

Step 2:
          He injected living strain of R into mice, the mice alive as he did not got any disease.

Step 3:
         He injected heat killed strain of S into mice and mice remain alive.

Step 4:
           He mixed living R strain with heat killed S strain and then inject into mice. As a result the mice died.

Conclusion:
                  It was found that genetic material from heat killed S stain were transferred to living R (non-virulent) strain, as a result R become virulent and cause the death of mice.

7 0
3 years ago
Can someone help me please
alexandr402 [8]

D)

Because a scientific theory is something that has been proven over the trials of many tests


Hope that helps :)

5 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • How would you cross two different incompletely dominant traits?
    8·1 answer
  • Diploid eukaryotic cells have two haploid sets of chromosomes, one contributed by the mother, the other contributed by the fathe
    13·1 answer
  • 1 2 3 will give brainliest for all three being right
    8·1 answer
  • Which are not displayed on a graph? observations predictions measurements data
    12·1 answer
  • 3. Which structures carry out life functions within cells?
    8·1 answer
  • When an orginism is repredused by budding, how does the new organism start growing?
    12·1 answer
  • You might say that this is a waste product of the plant (but it’s a good thing for you!). What is it?
    11·1 answer
  • Which of the following flows through ecosystems in one direction?
    9·2 answers
  • PLEASE HELP!
    13·2 answers
  • Identify the four phases in the life cycle of a cell and place the events in order, starting with events that occur immediately
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!