1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
11

Are

Biology
2 answers:
irina1246 [14]3 years ago
8 0

Answer:

A. All organisms

Explanation:

anastassius [24]3 years ago
4 0
It’s all organisms that are modified
You might be interested in
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Enlarged ________ in the brain, which hold cerebral spinal fluid, have been linked to schizophrenia.
OLga [1]
Answer is ventricles

Reason: Brain imaging studies reveal that people with schizophrenia have enlarged ventricles, the cavities within the brain that contain cerebral spinal fluid
7 0
2 years ago
What do all 3 rain forest have in common
sergeinik [125]

Answer:

The tropical rainforest biome has four main characteristics: very high annual rainfall, high average temperatures, nutrient-poor soil, and high levels of biodiversity (species richness). Rainfall: The word “rainforest” implies that these are the some of the world's wettest ecosystems.

6 0
3 years ago
1) Based on the graph above, what might have happened to
Mumz [18]

Answer:

More and more staeted showing up

Explanation:

5 0
3 years ago
____________ usually means rainy weather because moist air is rising. A. Rising air pressure B. Rising temperature C. Decreasing
AVprozaik [17]
Decreasing Tempeture
8 0
3 years ago
Read 2 more answers
Other questions:
  • The atmosphere traps a part of the Sun’s heat that is reflected from Earth’s surface. This effect, called the greenhouse effect,
    7·2 answers
  • Tom a gathered data by observing the cross section of the tree trunk that is shown below. Tom noted all the information below. W
    10·1 answer
  • In which scenario would mitosis be least desirable in terms of a species' survival?
    13·2 answers
  • A protein sample has been treated differently before being loaded onto the gel for SDS-PAGE. The first aliquot of the sample is
    11·2 answers
  • The erosion of rocks is an essential part of the ___________ Cycle.
    14·1 answer
  • What part of a vertebrate's brain is the center for thinking and complex behaviors?
    7·1 answer
  • Which of these organisms are most helpful in
    11·1 answer
  • How can you convert energy to particles?
    10·1 answer
  • Which of the following best defines a gene pool?
    8·2 answers
  • 1. How do uncapping enzymes contribute to regulation of gene expression?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!