1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
2 years ago
8

The sine of angle θ is 0.3. What is cos(θ)?

Mathematics
1 answer:
Sergio [31]2 years ago
6 0

The answer:

\sqrt{9}1 /10

Explanation to your question:

Since the sin of theta is 0.3, we can reasonably deduct that the opposite side to theta has a ration of 3 to 10 to that of the hypotenuse. Thus, the adjacent side to theta, using the pythagorean theorem, will be root91. Therefore, since the cosine of theta is the adjacent/hypotenuse, we get root 91/10

You might be interested in
Lena took a nap . she fell asleep at 11:37a.m and she woke up at 1:24p.m. how long did she sleep?
zalisa [80]
1 hour and 57 minutes
6 0
2 years ago
What is the remainder when 18,049 is divided by 14
kotykmax [81]

Answer:

3

Step-by-step explanation:

18,049 / 14 = 1289 and 3/14

So the remainder = 3

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

7 0
3 years ago
Read 2 more answers
Given f(x)=x2, g(x)=x+6, h(x)=7 find f{g[h(x)]}.
gogolik [260]

Answer:

169

Step-by-step explanation:

f(g(h(x))) = \\f(g(7)) =\\f(7+6) = \\(7+6)^2= 169

4 0
3 years ago
4y (4y - 4) - 4 (-4 + 5 + 4y²)<br><br> please simplify &lt;3
sasho [114]

Answer:

16y - 4

Step-by-step explanation:

4y(4y - 4) - 4(- 4 + 5 + 4y^2)

16y - 16y - 4(1 + 4y^2)

16y - 16y - 4(4y^2 + 1)

16y^2 - 16y^2 + 4

16y - 4

5 0
3 years ago
Joe went on holiday to Spain.
Hunter-Best [27]
Answers:

a. £2,090
b. My answer would be less because my total in euros would be divided by a greater number when converting euros to pounds.

Work for part a:

Apartment: 560•3= 1680 euros

Car: 20.16•15= 302.4 euros

1680+302.4=1982.4

1982.4/1.12 = £x/1

1982.4 / 1.12= £1,770

£1,770 + £320 = £2,090 total

Work for part b:
Example:
(instead of 1.12 I put 2 to see what would happen with a greater number)
1982.4 / 2 = 991.2

991.2 is less than 1,770 (the answer I got with 1.12)

Let me know if you need any clarification! :)
7 0
3 years ago
Other questions:
  • A submarine begin the day to 240 m below sea level. It descended 40 m/h for three hours and then ascended 30 m/hrs. for five hou
    8·2 answers
  • Factor 7x² – 31x – 20.
    9·2 answers
  • Jack's age is three years more than twice his younger brother Jimmy's age If the sum of their ages is at most 18 find the greate
    15·1 answer
  • Equation of the line (-6,5) and (8,14) in standard form
    8·1 answer
  • Sue played four games of golf.
    15·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • PONTOS GRATIS BRASIL ​
    10·2 answers
  • Find the value of the cosine
    6·1 answer
  • 3x+6-2 = 6x-(7/2*9/0)<br>​
    8·2 answers
  • How can I solve ¾ - (-5/12)?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!