1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
6

Base your answer to the question on the information below and on your knowledge of biology.

Biology
1 answer:
vodomira [7]3 years ago
3 0

Answer:

They can perform photosynthesis.

Explanation:

Autotrophs are organisms that can produce their own food, and heterotrophs are organisms that feed on other organisms. This means that the ameba and paramecium can eat only other microorganisms.

The euglena is not limited to this. Hypothetically speaking, if there were no other microorganisms around it (which is unlikely), the euglena would not die as long as it is exposed to sunlight. Thanks to chloroplasts, organelles that contain chlorophyll, it can perform photosynthesis - a process in which, with the help of sunlight, carbon dioxide, minerals, and water are used to synthesize food.

You might be interested in
How do small particles cross a cell membrane?
lora16 [44]
Active transport requires that the cell move engegy that it has obtained the food to move the molecule threw the cell membrane.The passive transport doesn't required as much energy for the molecule to move....
5 0
4 years ago
What Are the major group of photosynthetic bacteria
neonofarm [45]

The bacteria are :

Blue green algae

Rizobium

Rhizopus

7 0
3 years ago
Describe two types of living things that biologists could study.
Maslowich

Answer:

Animals or Plants

Explanation:

Describe two types of living things that biologists could study. Think about types of living things that are not in the ocean — what categories of living things are on land?(5 points)Two types could be animals and plants. Different categories that I know of are like reptiles, birds, and amphibians. 4.

3 0
3 years ago
Why do plants store their food?
Ierofanga [76]

Explanation:

Storing the food helps them to use it in winter and survive because there is very little sunlight available and so they photosynthesis less. When they have extra food they store it in their seeds and when the seed grows it gets it's food from the plant until the plant is able to photosynthesis and produce its food.

7 0
3 years ago
Read 2 more answers
How often two genes cross-over can tell us how far apart the genes are from each other. this is called recombinant frequency (rf
Roman55 [17]

Answer:

By finding recombination frequencies for many gene pairs, we can make linkage maps that show the order and relative distances of the genes on the chromosome ..

6 0
2 years ago
Other questions:
  • Describe the basic components of a tissue:
    11·1 answer
  • Produces growth hormone which mainly affects
    12·1 answer
  • What is the nerve responsible for?
    12·1 answer
  • It is important to study the effect of the concentration of the reactant and the feed rate on the
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A polygenic trait is contributed by two or more genes one gene two alleles multiple alleles
    10·2 answers
  • Describe the characteristics of the phospholipid bilayer that permit small hydrophobic lipid molecules to pass directly across t
    12·1 answer
  • It is possible for a repressor to negatively regulate the expression of an operon because: A. the repressor-binding site overlap
    12·1 answer
  • The yeast used to make beer can perform aerobic respiration or alcoholic fermentation. When O2 is available, yeast perform aerob
    5·1 answer
  • If a de-shelled egg gains weight after being soaked in sucrose solution, what term best describes this solution?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!