Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Explanation:
Using Ohm's law
V ( voltage) = I (current A) × Resistance R in ohms
R = 7.0 × 10⁹Ω
V = 80 mV = 80 / 1000 = 0.08 V
0.08 V = I × 7.0 × 10⁹Ω
a) I = 0.08 V / 7.0 × 10⁹Ω = 1.142857 × 10 ⁻¹¹ A
b) quantity of charge = I × t = 1.142857 × 10 ⁻¹¹ A × 0.85 s = 9.7142857 × 10⁻¹² C
number of Na⁺ ions ( q = +e) = 9.7142857 × 10⁻¹² C / 1.6 × 10⁻¹⁹ C = 60714285.714 Na⁺ ions
Well you see each of the seeds have developed a special technique that allows their individual seeds to travel further and lower the probability of landing close to the tree and not getting the sunlight it needs
For the berries birds and various animals eat them carrying them away so hopefully they can get more sunlight
Helicopter seeds do the same thing except the sides themselves float away from the tree to get a further distance.
Finally the acorn seeds of the oak tree use the same concept of the berries. Various squirrels do eat these kinds of nuts and bury them in the ground in hopes of finding them later. But due to squirrels not remembering where they buried their acorn seeds the acorns are well away from the tree and start growing.
So you see all of these tree seeds are specially developed to help it get away from the trees. Especially so that they can grow in a much better environment than the one provided to them initially.
The answer is; YES
All organisms share one common ancestor in the beginning of life. Different species have branched at different times from common ancestors hence he evolutionary tree looks like tree called a cladogram. The nodes represent the common ancestry while branches depict divergence. Therefore even fruit flies and the fruit bats even though they do not belong to the same species shared a common ancestor at one time in history.
Answer:
decomposer
Explanation:
just like the word decompose it eats away corpse so they can make fertilizer.
