1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zolol [24]
3 years ago
8

The element iron belong to what family?

Biology
1 answer:
yanalaym [24]3 years ago
7 0

Answer:

Transitions metals family hope this helps

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What is hypoglacemia and what are the symptoms of its?​
katrin2010 [14]

Answer:

Hypoglycemia is a condition where your blood sugar is lower than normal

Its symptoms are fatigue, irregular heartbeat, pale skin, shakiness, sweating, hunger, and anxiety

Explanation:

8 0
3 years ago
Which of the following best describes the function of the human nervous
Tema [17]

Answer:

A. The nervous system collects and responds to information about

the internal and external environment.

Explanation:

4 0
3 years ago
Biochemical function within any cell is determined largely by specific enzymes. Remember, enzymes are proteins. Different sets o
Tatiana [17]

Answer:

This is how cells gene regulation occur.

Explanation:

Regulation of gene expression is  very very important thing to maintain the normal levels of all body proteins according to our body"s requirement.

            During positive gene regulation enzymes of various metabolic pathways of the target cell is being activated,thus supplying the cellular need of various metabolites and proteins.

             During negative regulation various enzymes are  turned off thus blocking the formation of metabolites or proteins not required by the cell.

5 0
3 years ago
Give the correct which changes the given organisms are seen in order of their lifespan:
TEA [102]

Answer:

banyan tree --- parrot--- crow--- parrot.

3 0
3 years ago
Other questions:
  • Explain how weathering erosion and deposition happen in our enviroment
    9·1 answer
  • Why can the same earthquake have different ratings on the Richter Scale and the Moment Magnitude Scale?
    5·1 answer
  • Which is a advantage of sexual reproduction over asexual reproduction
    9·2 answers
  • A geneticist discovers a new mutation in Drosophila melanogaster that causes the flies to shake and quiver. She calls this mutat
    9·1 answer
  • As opposed to external fertilization, internal fertilization ensures that
    15·1 answer
  • How do the long strands of DNA fit into the nucleus of a single cell?
    7·1 answer
  • Birds in the chaparral biome have adapted to living _______.
    14·2 answers
  • Help please will give brainliest due soon
    13·1 answer
  • The diagram below represents part of a process that occurs in cells
    15·1 answer
  • In some oceans, large underwater mountains exist. Corals inhabit some areas of these underwater mountains but not others. Scient
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!