1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
14

What organ does NOT belong in the nervous system? Provide a small explanation from the internet.

Biology
2 answers:
ozzi3 years ago
7 0
It would be B spleen because the spinal cord is connected to the brain as well as dendrites

Hope this helps

Have a great day/night
raketka [301]3 years ago
4 0

Answer:

b

Explanation:

because the a.c.d are all connected :) hope i helped

You might be interested in
What is the phenotype and the genotype of the white flowered offspring shown in the Punnet square below? Explain how you know by
scoundrel [369]

Answer:

Genotype: The letters that make up the individual. E.g. TT or Tt. ▪ Phenotype: The physical characteristics of the particular trait. E.g. Tall or short. ▪ Dominant trait: Signified by capital letter-E.g. T.

Explanation:

Hope this helps pls mark brainliest.

3 0
3 years ago
I need some help answering a few questions. Please help there's four.
MaRussiya [10]
1. A trait is an element of personality that is relatively stable throughout the lifespan and across contexts. And Characteristics is a description of someone’s or something’s features.
2. Technically yes
(Sorry I didn’t know #3)
4. It’s a gene

7 0
3 years ago
Why does a very strong magnet attract both poles of a weak magnet
Alex Ar [27]
If realigns the domains of weaker magnet 
4 0
3 years ago
When calculating population growth
Oduvanchick [21]

Answer:

B. How soon the organism is able to reproduce.

4 0
3 years ago
Hydrolysis of carbohydrates you eat begin in your mouth as you chew. How do you think this process might be affected in a person
Luda [366]

Answer:

The carbohydrates will not be digested properly.

Explanation:

The kind of carbohydrates that a person takes from plants is in the form of amylose. From animals, a person will receive carbohydrates in the form of glycogen,

The digestion of carbohydrates begins as soon as the food is taken in the mouth by the amylase enzyme present in the saliva.

If a person does not have the salivary glands, then there will be no production of saliva and amylase enzyme. Hence, the carbohydrates will not be digested.

4 0
3 years ago
Other questions:
  • You are studying a bacterium that utilizes a sugar called athelose. This sugar can be used as an energy source when necessary. M
    10·2 answers
  • Which of the following is most likely to happen if oxygen is not able to enter a cell?
    12·2 answers
  • Sharks obtain all of their energy by eating other marine organisms, such as fish. Suppose that a marine scientist measures the c
    5·1 answer
  • Precipitation:
    13·1 answer
  • Which type of fault creates oceanic rifts and rift valleys?
    10·1 answer
  • What is the name given to a bacteriophage genome integrated into a host cell chromosome?
    8·1 answer
  • Modern age is the Age of Science and Technology. Justify the statement.​
    11·1 answer
  • The pancreas contains exocrine cells that secrete digestive enzymes into the ____________ , and clusters of endocrine cells call
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A fossilized fish is found that has jaws but no true bones. Where does this fossil belong on the cladogram?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!