I believe the correct answer from the choices listed above is the second option. <span>The building blocks of a habitat consist of environmental factors. Hope this answers the question. Have a nice day.</span>
This is true, for it is called redshift
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
To determine whether an acidic or basic solution, it is first necessary to compare the concentrations of the hydronium (H3O +) and hydroxide (OH-) ions in the solution.
In acidic solution, the concentration of H3O + ions is higher than that of OH- ions.
- In acidic solution, the concentration of H3O + ions is higher than that of OH- ions. Such a solution can be achieved by adding a small part of the H3O + ions, for example. Acid solutions have a pH below 7, the further away from 7 the pH of the solution is the higher its acidity content. According to Le Chatelier's principle, when a disturbance is caused to an equilibrium system, it tends to readjust in order to diminish the effects of that force. This means that if an acid is added to water, the H3O + ions will be in excess and the equilibrium will shift in the opposite direction to the left. Then these excess ions will react with the OH- ions. Thus, the concentration of OH- ions will decrease and the solution will become acidic.
- In basic solutions, the concentration of OH- ions is higher than that of H3O + ions. If we add a base to the water, it means that we will be adding OH- ions and, as explained in the previous section, by Le Chatelier's principle, the equilibrium of the water selfionization reaction will shift in the opposite direction, and the excess ions will react. with the H3O + ions, decreasing their concentration and making the basic solution. Basic solutions have a pH greater than 7, the farther from 7 and closer to 14 the pH of the solution, the higher the basification content.
Answer:
The change of the wick to carbon from the burning is a chemical change
