1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
3 years ago
14

As a result of the Federal Insanity Reform act of 1984 the following is true?

Law
1 answer:
Molodets [167]3 years ago
8 0

Answer:

C.) allowed the person to walk free if the verdict was not guilty by reason of insanity.

Explanation:

The Federal Insanity Reform act of 1984 is a reform act which allow a defendant who is the person who committed a crime to work freely if the decision of the jury was that the defendant was not found guilty by reason of Insanity or mental illness and therefore should not be blame or punished for the crime committed.

Therefore the Federal Insanity Reform act of 1984 allowed the person to walk free if the verdict was NOT GUILTY by reason of INSANITY.

You might be interested in
A country with a Confederal system has which type of central government?
stich3 [128]

Answer:

The confederate states of America in 1880

6 0
3 years ago
Read 2 more answers
The President can make a short term agreement with another country that lasts for the duration of his presidency without any app
Olenka [21]

Answer:

executive agreement

Explanation:

sa tingin ko lang po

3 0
3 years ago
Read 2 more answers
Madison Mayberry, a black woman, has worked in the mailroom at Worldwide Pictures for 16 years. When a mailroom supervisor posit
OLga [1]

Answer: Madison will not prevail because not every decision that is arbitrary or unfair is discrimination.

Explanation:

Based on the issues discussed in the question, if Madison files a complaint of racial discrimination with the Equal Employment Opportunity Commission(EEOC), it is highly unlikely that Madison will prevail based on the facts that were presented in this summary.

Madison already made a complaint to Renee who told her that she gave Sally the job because they are friends and she needed a better job after her divorce. There's no issue regarding discrimination in what happened on this case.

Fro her to prevail, she must prove specific violation in this case or demonstrate a pattern of discrimination in the workplace that has resulted in a race favored over another.

5 0
3 years ago
What did the judge revoke or deny derek chauvin?
Ivenika [448]

Answer:

The judge revoked Derek Chauvin's bail and said he would be sentenced in eight weeks. ... Chauvin was convicted on all three charges he faced at trial — second-degree murder, third-degree murder and second-degree manslaughter

6 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • True or False: In terms of percent, whiskey has more alcohol than wine.
    10·2 answers
  • Which of the following statements BEST supports the belief that a
    15·1 answer
  • Which of the following is Not a symptom of a strong emotions A) impulsiveness B) Hostility C)Blinderss
    6·2 answers
  • 7. What is the primary purpose of a statute?
    13·1 answer
  • How are judicial activism and judicial review related?
    10·2 answers
  • All elements of an offense have to be proven before someone can be charged with the crime.
    13·1 answer
  • How does sexual reproduction reduces the risk of genetic disease​
    15·1 answer
  • A tire manufacturer has recently discovered that numerous lots of tires
    9·1 answer
  • ***50 POINTS***One question*** <br> What is the difference between Procedural and Substantive laws?
    13·2 answers
  • Read the following passage:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!