1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
3 years ago
5

Which statement best differentiates between the terms supine and prone?

Biology
1 answer:
Rom4ik [11]3 years ago
3 0

Answer:

A. Supine is lying on the back; prone is lying with the back facing up

Have a good day!

You might be interested in
Using a food label, explain what each section will tell you and why that would be important to, say, a long-distance runner.
Harlamova29_29 [7]

Answer:

The following are the sections which can be seen in a food label:

1) Product dates:

Under this section look for the production date and the expiry date ( best before). The production date tells when the food was made. The expiry date tells the date before which the food has to be used.

2) Ingredient list:

The list of all the ingredients used for the preparation of the food is mentioned.

3) Nutrition Facts Label

At the top of this label, we will see the total number of servings and size of the container. Thus table shows some key nutrients and the percent of them present in the container of food. It also shows the calories of each. Percent Daily Value (DV) shows the percentage of each nutrient present.

The nutrient label are important to an athlete because he/she needs to take a diet which is capable of filling us nutrient requirements. Athletes tend to perform well when they have a balanced diet. To get a balanced diet, they need to look at the nutritional values.

7 0
3 years ago
The cells in the nervous system that fill spaces and give support to neurons are called
Dafna1 [17]
Neuroglial Cells is the answer
7 0
3 years ago
Soon after the island of hawaii rose above the sea surface (somewhat less than one million years ago), the evolution of life on
MrRa [10]
There are choices for this question namely:

<span>A) genetic bottleneck. 
B) sexual selection. 
C) habitat differentiation. 
D) founder effect.
</span>
The correct answer is founder effect. The definition of founder effect is the loss of genetic variation when a new population is established in a small number of individuals from a larger population. The larger population in the context is the ecosystem in Hawaii before it rose from the sea surface. After it rose above the sea surface, most organisms will not be able to survive in land but there will be a small population that can evolve from there. 
4 0
3 years ago
Please help me out with this!!<br> (Explain)<br> Thank you soo much!!<br> BRAINLIEST TO BEST ANSWER
WARRIOR [948]

Answer:

C. NAD⁺  

Step-by-step explanation:

NADH is oxidized to NAD⁺ in Complex I of the Electron Transport Chain.

NADH ⟶ NAD⁺ + H⁺ + 2e⁻

The electrons continue through the Electron Transport Chain, and the NAD⁺ is used in three places during the Krebs Cycle.

(a) Isocitrate to oxalosuccinate

Isocitrate + NAD⁺ ⟶ oxalosuccinate + NADH + H⁺

(b) α-Ketoglutarate to succinyl-CoA

α-ketoglutarate + NAD+ + CoA → succinyl CoA + CO₂ + NADH

(c) Malate to oxaloacetate

Malate + NAD⁺  ⟶ oxaloacetate + NADH + H⁺

The NADH produced by these three reactions can then be used by Complex I in the Electron Transport Chain.

6 0
3 years ago
Read 2 more answers
The elements in period 3 all have this characteristic
emmainna [20.7K]

Answer:

b

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following statements is true? Cloning creates genetically identical offspring. Recombinant DNA injects genes from b
    6·2 answers
  • Faking an exaggeration injuries are a natural part of sports True or False ?‍♀️
    13·2 answers
  • Explain the concept of reaction equilibrium and how the activities of enzymes depend on the temperature, ionic conditions, and p
    15·1 answer
  • The observation that abnormal cleavage of mannose residues from glycoproteins causes an autoimmune disease in mice supports the
    14·2 answers
  • Do dandelions have a fibrous root system or a tap system
    8·1 answer
  • Reproduction critically contributes to the variation within a<br> species.
    8·1 answer
  • The process by which an organism makes more of its own kind is
    13·2 answers
  • Taxonomy is ________
    13·1 answer
  • two liquids that are at two different temperatures are added to each other in a container is closed . The temperature is taken a
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!