1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
12

Using what you read in this passage, evaluate the following vacation

Biology
1 answer:
madam [21]3 years ago
7 0
Answer is b hole this helps
You might be interested in
NO LINKS PLEASE
ella [17]

Answer:

blood flows through pores in the tissues

8 0
3 years ago
PLEASE HELP IM ONA ON TEST
frez [133]

Answer:

D. Type of Liquid

Hope This Helps!

6 0
3 years ago
Sex-linked Inheritance-Biology? Which of the following is true of an X-linked gene, but not of a Y-linked gene?
Katena32 [7]
XX shows female
XY shows male
answer will be E as it is present on both genes.
5 0
3 years ago
2. The first step of the light<br> reactions, (blank)<br> strikes the chlorophyll in (blank)
kkurt [141]

The first step of the light

reactions, (photons)

strikes the chlorophyll in (photosystem II)

4 0
2 years ago
Which best describes the brain stem?
zepelin [54]
The answer is C. The brain stem controls blood circulation.
4 0
3 years ago
Read 2 more answers
Other questions:
  • All anterior pituitary hormones except growth hormone affect their target cells via a cyclic amp second-messenger system.
    14·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Showing change in the composition of a population's gene pool demonstrates that evolution has occurred.
    15·1 answer
  • Which statement best describes the process that occurs in the thylakoid
    14·1 answer
  • Jared Harless shattered his elbow in a snowboarding accident and decided to visit a doctor at Smith Union Hospital for treatment
    6·1 answer
  • Now, raise one of your hands just slightly and press both hands together again. This motion models a thick plate pressing agains
    13·2 answers
  • Which is the smallest particle of a macromolecule?<br><br> a. monomer <br> b. Polymer
    7·1 answer
  • Can someone help me with my lab report plz.
    8·1 answer
  • Describe the connection between limiting factors and invasive spicies
    6·2 answers
  • A Gram + bacterium that inhibits the growth of other Gram + bacteria is an example of what?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!