Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
<h3><u>2</u><u>4</u><u>0</u><u> </u><u>is</u> the answer</h3>
Homeostasis is the attempt to maintain stable conditions (particularly in an organism). It is done by using feedback loops (positive and negative).
Answer:
The evolution of the heart is based on the separation of oxygenated blood from deoxygenated blood for efficient oxygen transport. pisces have a dual chambered heartwhile reptiles and amphibians are having a three chambered finally aves and mammals have four chambered hearts.
Explanation:
please mark as brilliant answer
Answer:
Option (D).
Explanation:
Skeletal muscles is one of the most important types of muscle that regulate the contraction of skeletal muscles of the body. The skeletal muscle is controlled by the somatic nervous system.
Skeletal muscles are multi nucleate contains large number of nucleus in their structure. The multiple nucleus increases the ability of muscle to produce large number of enzymes. These enzymes are proteins are important for the muscle contraction.
Thus, the correct answer is option (D).
