1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
2 years ago
14

Are harbor seals a K-selective or R-selective species?

Biology
1 answer:
Semenov [28]2 years ago
4 0

Answer:

They are K-selective

Explanation:

Because harbor seals are mostly captured by humans and are very endangered which are most likely to not survive for the long-term.

You might be interested in
All atoms of the same element must have the same number of
kherson [118]

Answer:

protons..................

4 0
3 years ago
Read 2 more answers
What is one impact of carbon emissions on the country of peru? increased lung and other cancers andes glaciers will disappear re
Simora [160]
I am not sure but I think the answer is B the Andes glaciers will disappear
8 0
3 years ago
Read 2 more answers
What is an agricultural subsidy?
jenyasd209 [6]

Answer:

A sum of money paid to farmers and agribusinesses by the government to

supplement their income and manage crop supply

7 0
2 years ago
What information is not required on the nutritional portion of a food label?
Anna007 [38]

i had this question and it was price

hope this helps


7 0
3 years ago
Read 2 more answers
How do the sun, earth, and moon affect each other??
lesya [120]
So when the Moon<span> rotates around the </span>earth<span> is pulls the water away from the </span>earth<span>causing high tides. Low tide is caused by the </span>moon<span> and </span>sun<span> working at right angles to </span>each other<span>, their gravitational forces effectively cancel </span>each other<span>out.</span>
8 0
2 years ago
Other questions:
  • How many chambers does the human heart have?
    11·2 answers
  • A scientists finds an organism that cannot move. it has many cells, produces spores, and gets food from its environment. in whic
    11·1 answer
  • Seth is chatting with his friends in a café. Suddenly, the power goes off, and it’s completely dark. After a few moments, he’s a
    13·2 answers
  • Fatty acids and glycerol are produced from the metabolism of
    9·1 answer
  • In which phase of meiosis will sister chromatids seperate and move to opposite ends of the cell?
    7·1 answer
  • Explain how dead plants can be formed into fossil fuels
    9·2 answers
  • What are the frequencies of each offspring genotype in a cross between rr female and a rr male? see section 14.2 (page 293) . vi
    15·1 answer
  • a neutral iron molecule has an atomic number of 26. How many electrons does this atom have? Explain the reason you used to get y
    5·1 answer
  • 95% of plastics in the ocean are
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!