An ant and a stone are on a circular disc, which is rotating at a constant speed. The stone is fixed to the disc. The ant is mov
1 answer:
Find attached the options
Answer:
The option B in the attached is correct
Explanation:
In the given scenario the ant and stone are on the same disc and the stone is fixed.
The disc is moving at a constant speed in a clockwise direction while the ant is moving in the opposite direction.
The starting position is also attached with the ant opposite the stone.
So for a full rotation the ant would have gone round and met up with the stone.
If the disc completes a 3/4th revolution it will be at the position in B. The ant would have gotten to the stone by half revolution, and by 3/4th revolution it would have gone a quarter of the disc from the stone as shown
You might be interested in
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
