1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
2 years ago
11

An ant and a stone are on a circular disc, which is rotating at a constant speed. The stone is fixed to the disc. The ant is mov

ing along the rim in the opposite direction and at the same speed as that of the disc. Which of these shows the position of the ant and the stone after the disc completes 3/4th of a revolution?
Biology
1 answer:
Fittoniya [83]2 years ago
6 0

Find attached the options

Answer:

The option B in the attached is correct

Explanation:

In the given scenario the ant and stone are on the same disc and the stone is fixed.

The disc is moving at a constant speed in a clockwise direction while the ant is moving in the opposite direction.

The starting position is also attached with the ant opposite the stone.

So for a full rotation the ant would have gone round and met up with the stone.

If the disc completes a 3/4th revolution it will be at the position in B. The ant would have gotten to the stone by half revolution, and by 3/4th revolution it would have gone a quarter of the disc from the stone as shown

You might be interested in
Where is the moon's gravitational pull the strongest?
Romashka-Z-Leto [24]
The pull is strongest at oceans.
5 0
2 years ago
An _______ is a large section of air that has an even temperature, humidity, and A pressure. ​
nasty-shy [4]

Answer:

Air mass

Explanation:

6 0
2 years ago
Read 2 more answers
What main carbohydrate do grapes have
ludmilkaskok [199]

the main carbohydrate in grapes is sucrose

5 0
2 years ago
Many plants are dwarfed, but their few blossoms may be full-sized. Cushion plants, looking like ground-hugging clumps of moss, e
Evgesh-ka [11]
The answer is Tundra I took the quiz <33
6 0
2 years ago
Read 2 more answers
Describe the function of the kidneys in the excretory process
zzz [600]

coaster_crazzy

Best Answer:  Each of these organs moves METABOLIC wastes out of the blood stream.  

Lungs move CO2 out of the blood  

Skin excretes uric acids out in sweat  

Kidneys filter uric acids out into urine, along with excess water and other compounds  

Liver also filters metabolic wastes from the bloodstream.


4 0
2 years ago
Read 2 more answers
Other questions:
  • A bird's ability to fly south then winder weather approaches is an example what<br><br> adaptation?
    7·1 answer
  • The flow of electrons down the respiratory chain allows the active transport of _________ to the outside of the cytoplasmic memb
    11·1 answer
  • Which of the following will occasionally produce a duplicate gene?
    15·2 answers
  • A stream valley landform is the most common result of _____.
    14·2 answers
  • What is the relationship between temperature and the dissolution of ocean water salts?
    9·2 answers
  • 3. Which organism could be labeled as both a secondary consumer AND a tertiary consumer? *
    7·1 answer
  • what variable is measured in a experiment? A. independent variable B. experimental variable c. Dependent variable
    15·1 answer
  • An ecosytem is a community of organisms at a major regional or global level
    9·1 answer
  • The sequence of nucleotides in an mRNA is 5’AUGACCCAUUGGUCUCGUUGGCUGAAGUCA 3’.
    10·2 answers
  • 3. Draw the letter ""e"" that you see under low power only. Answer:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!