Answer:
Explanation:
Urea is the cellular waste product that the kidneys remove from the blood.Kidneys are the two bean shaped organs that has several functions to keep the body healthy. It not only removes urea from the blood, but also helps in the formation of urine and maintaining the fluid level of the body. The two kidneys are placed on the two sides of the spinal cord. The blood enters the kidney through the renal artery. The nephron within the kidneys mainly take out the waste products and the excess water from the blood and purifies it.If the kidneys of a person fail to work properly then it becomes important to perform dialysis for taking out the waste materials from the blood.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<span>A six-carbon sugar is an example of a molecule </span><span>that can join with other molecules to form a carbohydrate such as starch or cellulose.</span>
Answer:
Explanation:
Immune response Evidence points to the fact that this early microbial colonization helps our body to defend itself against disease.
