Answer:
The economic principle that helps ensure that scarce resources are allocated efficiently is "the profit motive."
Explanation:
In economics, the profit motive is the inspiration of organizations that function so as to exploit their profits. Conventional micro-economic concept suggests that the eventual goal of a commercial is to make money. Specified differently, the aim for a business's presence is to chance a profit. The profit motive is the craving to make money. In a free market (where people willingly swap money, goods and services, the profit motive agrees who grows what. In theory, the profit motive dispenses resources efficiently, but in practice there are some problems.
Answer:
Cellular respiration is the process of breaking sugar down into a form that the cell can utilize as energy.
Explanation:
This happens in all types of life. Cellular respiration takes in food and uses it to produce ATP, a chemical which the cell uses for energy. Typically, this process uses oxygen and is known as aerobic respiration.
<em>I hope this was helpful!</em>
Answer:
Explanation:
Loess is a sediment that is formed from silt deposits due to wind. The composition of the silt is clay and sand. The components are cemented together by calcium carbonate. The silts are blown by wind and accumulate in a singular location.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
When raisins are placed in water and sit overnight, endosmosis takes place. Water goes into the raisins from the surrounding. Due to this endismosis, the raisins gain water and become larger in volume.
Since raisins absorbed some water, the volume of water from the container decreases.
