1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
2 years ago
12

HELP I WILL GIVE BRAINLYEST I NEED A ANSWER QUICK THO!

Biology
1 answer:
Scilla [17]2 years ago
6 0
I believe it is the last choice
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Garlic mustard has been introduced to the beetles ecosystem. Describe what would happen to the beetles population as a result an
lbvjy [14]

Answer:

It would collapse

Explanation:

Garlic mustard also produces root exudates that inhibit the growth of important soil fungi and leaf chemicals that kill native butterfly larvae that feed on the plant

In addition, invertebrates and other consumers that rely on these natural plant species for food are harmed by the spread of this invasive "weed". Garlic mustard also produces root exudates that inhibit the growth of important soil fungi and leaf chemicals that kill native butterfly larvae that feed on the plan

4 0
2 years ago
State the differences in compositionof blood between the aorta and main vein
Ad libitum [116K]

Answer:

The placenta is a unique vascular organ that receives blood supplies from both the maternal and the fetal systems and thus has two separate circulatory systems for blood: (1) the maternal-placental (uteroplacental) blood circulation, and (2) the fetal-placental (fetoplacental) blood circulation. The uteroplacental circulation starts with the maternal blood flow into the intervillous space through decidual spiral arteries. Exchange of oxygen and nutrients take place as the maternal blood flows around terminal villi in the intervillous space. The in-flowing maternal arterial blood pushes deoxygenated blood into the endometrial and then uterine veins back to the maternal circulation. The fetal-placental circulation allows the umbilical arteries

Explanation:

3 0
2 years ago
Read 2 more answers
Which evidence supports the big bang theory?
kogti [31]

Answer:

Umm im a Christian and dont believe in the big bang but i do like to help people but the best one is the Radiation is detected in every direction due to the discovery in the 1960s of cosmic microwave background radiation.

Explanation:

4 0
2 years ago
Read 2 more answers
Would trout dna be more similar to bass dna or deer dna?Explain why using science vocabulary
olasank [31]
It would be similar to bass dna since trout is another kind of fish like bass. They come from the same family group so it would be more similar to it.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which describes a concept that was not previously known but but was developed as a direct result of Mendel’s experiments with pe
    6·2 answers
  • Describe the typical principles used to identify topogenic sequences within proteins and how these principles can be used to dev
    12·1 answer
  • If plants ceased to perform the light-independent reactions
    13·1 answer
  • Which statement best explains why meiosis produces haploid cells rather than diploid cells?
    11·1 answer
  • Select the correct answer.
    14·1 answer
  • Which of the following body cavities contains the urinary bladder?
    10·2 answers
  • Hey ! what is the difference between a habitat and a niche?
    5·2 answers
  • Help will mark brainliest
    15·1 answer
  • Help please! (Easy question) I think it's D
    9·2 answers
  • What is the rate of person blood in one day​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!