1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
7

What is the building block of all living things?

Biology
1 answer:
mylen [45]3 years ago
4 0

Answer:

cell

Explanation:

is a building block of living things

You might be interested in
Which of the following is TRUE about what occurs in the chemical reaction of cellular respiration? CHOOSE ALL THAT APPLY (there'
GREYUIT [131]
I believe that B and D are the only answers that I am sure of. C is incorrect and A seems incorrect as well. E may be a correct answer, but you will need to check the chemical equation. Hope this helps!
6 0
3 years ago
Read 2 more answers
There are 4 molecules racing to get across a typical cell membrane.
skad [1K]
  • It’s (D)
  • Explanation:
5 0
3 years ago
Read 2 more answers
A/an _____ is used to enlarge the opening of any body canal or cavity to facilitate the inspection of its interior.​
pshichka [43]
A speculum is used to enlarge the opening of any body cavity or canal to facilitate inspection of the interior
4 0
4 years ago
"Mitosis and Meiosis I are very different, but Mitosis and Meiosis II are very similar. Therefore, Meiosis I must cause all the
Arada [10]

Answer:

<h2>Agree </h2>

Explanation:

1. Through mitosis, Parental cell divide into two daughter cells with same number of chromosomes.

While meiosis produce 4 daughter cell from a single cell  with half the number of chromosomes as compared to parental cell.

2.Meiosis have two cycles , i) meiosis I and ii) meiosis II.

3. In meiosis I, chromosomes first go replication and become double, then cell  inter into meiosis I then into meiosis II and finally  produce four haploid daughter cells. It is the first step (meiosis I) that generates genetic diversity. During prophase I of meiosis I (meiosis)  homologous chromosomes pair and form synapses, a special step of meiosis, which is the main reason of causing diversity.

4. There is crossing over which produce genetic diversity between gametes.

7 0
4 years ago
Read 2 more answers
Which of the following are responsible for sending messages from the
klio [65]

Answer:

C. Interneurons

Explanation:

A.P.E.X.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Most _____ are crops like corn, goldenrod, or clover.
    6·2 answers
  • It's a cloudy and rainy day. The air pressure is most likely _____. low, stable, high, increasing
    14·1 answer
  • Sexual reproduction amongst protozoa is done by _____.
    14·2 answers
  • Brain weight triples during the first two years of life primarily because of the growth of _____.
    11·1 answer
  • Please answer, I'll give points and brainlest.
    14·2 answers
  • Stacy bought two vegetables. One of them is scaly with a few buds and the other has hairy structures. Which parts of the vegetab
    8·1 answer
  • Organic compounds are made up of all except which of the following elements
    13·1 answer
  • In the body, the homeostasis of which element is related to properties of bone?
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Guys pakisagot po yan huhuhu​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!