1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
2 years ago
14

Describe the process of photosynthesis to explain at least 1 requirement for photosynthesis that would need to be considered for

chloroplasts to function in an animal or a human.
Biology
1 answer:
baherus [9]2 years ago
8 0

Answer:

the process by which green plants and some other organisms use sunlight to synthesize nutrients from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a by-product.

You might be interested in
What are some basic steps to saving tropical rainforests?
sp2606 [1]

Teach others about the importance of the environment and how they can help save rainforests. Restore damaged ecosystems by planting trees on land where forests have been cut down. Encourage people to live in a way that doesn't hurt the environment. Establish parks to protect rainforests and wildlife.

Hope this helps

4 0
3 years ago
Read 2 more answers
In your own words, describe the Gaia hypothesis.
Anastaziya [24]
The Gaia hypothesis, named after the ancient Greek goddess of the Earth, asserts that the Earth and its biological processes function as a single, massive organism. This organism has tightly controlled self-regulatory negative feedback loops that keep the planet's circumstances within life-friendly bounds.
5 0
2 years ago
Anomalous development of 3rd and 4th branchial pouches leading to thymic hypoplasia is the mechanism of defect for
melisa1 [442]

The anomalous development of 3rd and 4th branchial pouches which leads to thymic hypoplasia particularly the 22q11.2 deletion is the mechanism of defect for Di-George Syndrome or DGS.

This is a primary immunodeficiency disease caused due to abnormal migration and development of tissues and certain cells during the course of foetus development.

There are certain functional deficiencies such as decrease in number of the T-cells, normal or decreased serum Ig, and normal B-cells.

The Di-George syndrome has a micro deletion of the chromosome 22q11.2 also known as the DGS critical region is also referred to as 22q11.2 deletion syndrome.

The symptoms of Di-George syndrome include developmental delay, congenital heart problems, cleft palate and frequent infections.

The Di-George syndrome is caused by deletion of 30 or 40 genes in the middle of chromosome 22, the particular location known as 22q11.2. Every person has 2 copies of chromosome 22, one inherited from each parent. If a person has Di-George syndrome, one copy of the chromosome 22 is missing a segment which includes around 30 to 40 genes.

The deletion of the genes from the chromosome 22 is a random event of father’s sperm or the mother’s egg.

The effects of this syndrome vary widely and have its effect on several parts of the body. Infections are common in this syndrome due to the problems arising in the immune system’s mediated response as in some patients the hypo plastic thymus is absent.

Children diagnosed with Di-George syndrome have a particular profile of neuropsychological test.

Patients who have Di-George syndrome can develop some autoimmune disorders at a higher rate than the general population. The exact mechanism which causes this syndrome and the features associated with it are still not known completely.

The diagnosis of the Di-George syndrome is done basis the symptoms at the time of birth or which develop soon after birth and get confirmed through genetic testing. Exact treatment and cure for Di-George syndrome is still not known but certain individual features are treated using the available standard treatments.

6 0
3 years ago
Read 2 more answers
How does the genetic drift affect the genetic diversity of a population?
madreJ [45]
In genetic drift new species forms which is reproductively different from pre existing species .in this way <span>genetic drift affect the genetic diversity of a population.</span>
3 0
3 years ago
Number the steps to carry out an investigation:
Helga [31]

Explanation:

Number the steps to carry out an investigation:

8 0
2 years ago
Other questions:
  • 1 point
    6·1 answer
  • How many genotypes are possible for the offspring
    14·1 answer
  • Which two organelles can be found in a plant cell that are not found in animal cells ​
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • 2. This cell structure acts as the "brain" or command center for the cell.
    11·1 answer
  • How do geologic timelines help scientists?
    9·1 answer
  • g If a person takes a prescribed dose of 10 milligrams of Valium, the amount of Valium in that person's bloodstream at any time
    5·1 answer
  • How did Hershey and Chase use radioactivity to draw a conclusion about proteins and DNA?
    12·1 answer
  • Please help!! the sooner the better
    7·1 answer
  • Please help me asap it should go in 5mins​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!