1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
2 years ago
7

For the following question, match the key event of meiosis with the stages listed below. I. Prophase I V. Prophase II II. Metaph

ase I VI. Metaphase II III. Anaphase I VII. Anaphase II IV. Telophase I VIII. Telophase II Centromeres of sister chromatids disjoin and chromatids separate.
Biology
1 answer:
Andrei [34K]2 years ago
3 0

Answer:

VII. Anaphase II

Explanation:

During metaphase II, fibers of the spindle apparatus drive chromosomes to the cell equatorial plane, where they line up. Sister chromatids are holden together until they reach <u>Anaphase II</u><u>,</u> during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase II, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again in each pole

You might be interested in
What does circe predict will occur if odysseus raids the cattle of helios?
pantera1 [17]
All of his men will die and he will not make it home in which he plans.
3 0
3 years ago
How do C4 plants fix carbons?
OverLord2011 [107]

Answer:

C4 plants—including maize, sugarcane, and sorghum—avoid photorespiration by using another enzyme called PEP during the first step of carbon fixation. ... PEP fixes carbon dioxide into a four-carbon molecule, called malate, that is transported to the deeper bundle sheath cells that contain Rubisco.

Explanation:

3 0
3 years ago
Reproduction is a process by which an organism produces offspring, or young, and passes on its traits or characteristics. Mitosi
Ivanshal [37]

Answer:

D i think would be the best answer my studie in this part of health is low

6 0
3 years ago
Read 2 more answers
Which best describes the main sources of energy in the United States?
Sever21 [200]

Answer:

D

Explanation:

Most of the energy in the United States comes from the burning of fossil fuels (coal, oil, natural gas). Hope this helps!

3 0
3 years ago
Read 2 more answers
Help quck!!!!!!!!!biology
Nataly_w [17]

Answer:

107 m/s

Explanation:

speed = distance / time taken

speed  = 0.914 / 0.00854  

speed = 107.0357 m/s  

round off ( 107.0357 ) = 107 m/s

4 0
2 years ago
Other questions:
  • What landform is the result of magma hardening in a volcano’s pipe?
    10·1 answer
  • When providing a patient report via radio, you should protect the patient's privacy by:?
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Blood type A- would give which of the following results?
    8·1 answer
  • When the micturition reflex is initiated, the brain responds by __________ action potentials (aps) in somatic motor neurons, res
    13·2 answers
  • Which one ?!!!?!?!?!?!?
    14·1 answer
  • Easy 10 points , look at the picture and answer the question
    12·1 answer
  • A population of wolves predates a population of moose on Isle Royale, Michigan, where there are fewer wolves than moose to start
    6·1 answer
  • Which statement best describes how Watson and Crick's model used other scientists' work to create a model of DNA?
    14·2 answers
  • _____ acts on proteins to produce peptides which are later broken down into _____ in the small intestine
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!