1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
14

The skeletal and muscular systems of human are shown above. List three systems,

Biology
1 answer:
jarptica [38.1K]3 years ago
8 0

Answer:

The other systems I am aware of are...

Immune System: fights off disease-causing germs and other harmful substances

Respiratory System: works to move oxygen throughout the body and clean out waste gases like carbon dioxide

Cardiovascular System: delivers oxygen, nutrients, hormones, and other important substances to cells and organs in the body using blood

Nervous System: transmit signals between different parts of the body so we can move our muscles

Digestive System: breaks down food into small molecules, which are then absorbed into the body

Excretory System: removes waste from the human body

You might be interested in
What is carbon fixation?
irina1246 [14]

Answer:

D.both A and B

Explanation:

because if there some option,like abcd and the letter d. is both a and b that is the correct answer.

8 0
3 years ago
the biological species concept proposed by states that a biological species is a population whose members can interbreed and pro
jek_recluse [69]

The biological species concept proposed by Mayr states that a biological species is a population whose members can interbreed and produce fertile offspring.

<h3>What is the biological species concept?</h3>

The biological species concept is a model used in biology sciences to delimit a species through mating fertile features of the individual that belong to such species.

This concept (biological species concept) was proposed by Ernst Mayr to understand how each species represent a functional unit.

In conclusion, the biological species concept was proposed by Mayr and states that a biological species is a population whose members can interbreed and produce fertile offspring.

Complete question:

Fill the blank. The biological species concept proposed by ______ states that a biological species is a population whose members can interbreed and produce fertile offspring.

Learn more about the biological species concept here:

brainly.com/question/985104

#SPJ1

4 0
2 years ago
The process by which energy moves through an ecosystem can be represented by
frutty [35]

Answer:

To show the flow of energy through ecosystems, food chains are sometimes drawn as energy pyramids. Each step of the pyramid represents a different trophic level, starting with primary producers at the bottom. The width of each step represents the rate of energy flow through each trophic level.

Explanation:

3 0
3 years ago
Read 2 more answers
Explain what is meant by the term environmental justice.
Artemon [7]

Answer:

Environmental justice is the fair treatment and meaningful involvement of all people regardless of race, color, national origin, or income with respect to the development, implementation, and enforcement of environmental laws, regulations, and policies.

Explanation: During the Civil Rights Movement in the 1960s, activists participated in a social movement that created a unified atmosphere and advocated goals of social justice and equality. The community organization and the social values of the era have translated to the Environmental Justice movement

5 0
4 years ago
PLEASE HELP ASAP IM TIMED!! 100 PTS WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST AND CORRECTLY
Vesna [10]

Answer: More than 99 percent of all organisms that have ever lived on Earth are extinct. As new species evolve to fit ever changing ecological niches, older species fade away. But the rate of extinction is far from constant. At least a handful of times in the last 500 million years, 75 to more than 90 percent of all species on Earth have disappeared in a geological blink of an eye in catastrophes we call mass extinctions.

Though mass extinctions are deadly events, they open up the planet for new forms of life to emerge. The most studied mass extinction, which marked the boundary between the Cretaceous and Paleogene periods about 66 million years ago, killed off the nonavian dinosaurs and made room for mammals and birds to rapidly diversify

4 0
4 years ago
Other questions:
  • Why do you think it is advantageous for a cellular slime mold to form a fruiting body when food is scarce?
    9·1 answer
  • To determine which colors of light are best used by plants for photosynthesis
    10·1 answer
  • I am shiny. I form +1 ions. There's more!
    10·2 answers
  • What is the major ingredient of magma
    10·2 answers
  • Why would a doctor do blood tests on a pregnant woman?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Como la reducción de impuestos ayuda a la economía
    14·1 answer
  • Which is an example of two
    10·2 answers
  • Please help me out i’ll give brainlist
    14·1 answer
  • the initial consequences of oxygenic photosynthesis are: removal of carbon dioxide and replacement of molecular oxygen in the en
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!