Answer:
The James-Lange theory of emotion.
Explanation:
According to the James-Lange theory, emotion is equivalent to the array of physiological arousal resulting due to external incidents. The two scientists indicated that for someone to feel emotion, he or she must first encounter with bodily responses like increased heart rate, increased respiration, or sweaty hands.
Once this physiological reaction is determined, then the individual can suggest that he or she is feeling the emotions. This is in contrast to the general common-sense way of thinking regarding the cause and effect association between the experience of emotion and its expression.
Answer:
Emphysema ;A condition often caused by smoking,
Bronchitis ; The inflammation of bronchioles in the lungs
Asthma ; A condition in which an attack can trigger
Pneumonia ; The build up of fluid in the alveoli of the lungs
Explanation:
I hope it helps :)
The step in translation initiation that is unique to the eukaryotes is:
<span>formation of the preinitiation complex ribosome assembly
</span>
Here are the processes involved in the Translation Initiation of Eukaryotes
1) 5'cap is used to position the mRNA on the 40S ribosomal subunit
2) ribosome scans down the mRNA looking for an AUG.
3) There is an initiator methionine-tRNA
4) The initiating AUG codon is often within a consensus sequence called the Kozak sequence (5'-ACCAUGG-3')
5) After binding the cap, ribosomes scan down the mRNA until the Kozak sequence is reached and translation begins
<span>6)The poly (A) tail and 5'-cap binding proteins help the initiation complex form
</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.