1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
3 years ago
8

A species of plant produces purple or white flowers. The results of crossing a purple and a white flower and two white flowers a

re shown in the diagram. Which of the following terms best describes the purple flowers?
A. recessive
B. Dominant
C. hybrid
D. codominant​
Biology
1 answer:
Aleks04 [339]3 years ago
7 0

Answer:

Recessive

Explanation:

You might be interested in
When someone is angry, their respiration, heart rate, and sweating increase. The same responses are also seen when someone is af
slamgirl [31]

Answer:

The James-Lange theory of emotion.

Explanation:

According to the James-Lange theory, emotion is equivalent to the array of physiological arousal resulting due to external incidents. The two scientists indicated that for someone to feel emotion, he or she must first encounter with bodily responses like increased heart rate, increased respiration, or sweaty hands.  

Once this physiological reaction is determined, then the individual can suggest that he or she is feeling the emotions. This is in contrast to the general common-sense way of thinking regarding the cause and effect association between the experience of emotion and its expression.  

4 0
3 years ago
Match the following respiratory conditions to the
dimaraw [331]

Answer:

Emphysema ;A condition often caused by smoking,

Bronchitis ;     The inflammation of bronchioles in the lungs

Asthma ; A condition in which an attack can trigger

Pneumonia ; The build up of fluid in the alveoli of the lungs

Explanation:

I hope it helps :)

8 0
3 years ago
Which step in translation initiation is unique to eukaryotes? which step in translation initiation is unique to eukaryotes? bind
Hitman42 [59]
The step in translation initiation that is unique to the eukaryotes is:

<span>formation of the preinitiation complex ribosome assembly
</span>
Here are the processes involved in the Translation Initiation of Eukaryotes

1) 5'cap is used to position the mRNA on the 40S ribosomal subunit
2) ribosome scans down the mRNA looking for an AUG.
3) There is an initiator methionine-tRNA
4) The initiating AUG codon is often within a consensus sequence called the Kozak sequence (5'-ACCAUGG-3')
5) After binding the cap, ribosomes scan down the mRNA until the Kozak sequence is reached and translation begins
<span>6)The poly (A) tail and 5'-cap binding proteins help the initiation complex form
</span>

4 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Help pls!!!!!!!!!!!!!!!!
Aleks [24]

Answer:

1.) Ozone

2.) Carbon dioxide

3.) Oxygen

4.) Water vapor

5.) Sulfur dioxide

Hope this helps!

3 0
3 years ago
Other questions:
  • The structure of eugenol is given below. select which functional group below is present in eugenol.
    15·1 answer
  • Pleaseeee help!!!!!! I will mark you as brainlinest for correct answer!!!!!!
    14·2 answers
  • A patient arrives at the office complaining of being dizzy when getting up from a chair. the patient's supine blood pressure is
    9·1 answer
  • Consider a field plot containing 200 kg of plant material. Approximately how many kg of carnivore production can be supported? A
    12·1 answer
  • People with panic disorder show dysregulation of norepinephrine systems in an area of the brainstem called the:_________.a. basa
    11·1 answer
  • Which best describes meiosis?
    14·1 answer
  • The ultimate purpose of the digestive system is to:
    6·1 answer
  • 60 PT!! PLZ HELP ;(
    10·1 answer
  • Which statement is true about the nitrogen bases in DNA and RNAI
    8·1 answer
  • Reabsorption of filtered glucose from the lumen in the pct is largely by means of:______.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!