1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna71 [15]
3 years ago
11

Use the drop-down menus to choose the correct answer to complete each statement

Biology
1 answer:
USPshnik [31]3 years ago
6 0
Answer:
Moon, planet, planet
Explanation:
Moons revolve around planets, Jupiter is considered a planet because it revolves around the sun, and a planet is a body that revolves a star.
Naetoosmart
2 years ago
Thank you
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
I need help quick please
LenKa [72]

Answer:

Polyploid cells have more than 2 sets of each chromosome. Hope that helped! :)

7 0
3 years ago
Read 2 more answers
Ginger is a modified stem called a rhizome. New shoots can form from a rhizome, allowing the plant to undergo a period of dorman
Paul [167]
A. Food Storage is the answer.
5 0
3 years ago
Which of the following is not a source of atmospheric carbon?
garik1379 [7]

Answer:

fossil fuel doesnt need atmospheric carbon for burning

5 0
3 years ago
How does a streak test help identify different minerals?.
erastovalidia [21]

Answer: determine the color of a mineral in powdered form.

Explanation:

5 0
2 years ago
Other questions:
  • What is the middle portion of a forest beneath the tree crowns
    12·1 answer
  • Choose the term that best matches the description given. Worms that are often parasites of the digestive system
    12·1 answer
  • uit flies are commonly used in genetic investigations that focus on traits passed from parents to offspring over several generat
    12·1 answer
  • What do you call water stored beneath the land
    14·1 answer
  • The image shows an ant that has been infected by a fungus, with the sporangium of the fungus emerging from the ant’s head. What
    9·1 answer
  • Which atmosphere gas most directly influences the rate of photosynthesis
    15·1 answer
  • What is one way that recent advances in veterinary medicine has changed how we care for our pets
    9·1 answer
  • The antibiotic penicillin which made from fungi is harmfull for bacterias?​
    11·1 answer
  • How do vasoconstriction and vasodilation contribute to the homeostasis of body temperature ?​
    5·1 answer
  • I need help with this
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!