All categories

3 years ago

The ________ is the brain structure most involved in perceiving interoception or sensations within the body.

Biology

1 answer:

Ludmilka [50]3 years ago

5 0

Answer: The question is incomplete, options are not given and here are the options gotten from another website.

a. Thalamus.

b. orbitofrontal cortex

c. insula

d. fornix

The correct option is C.

Insula.

Explanation:

It is insula because insula is a part of the cerebral cortex that is found within the lateral sulcus that separates the parietal and frontal lobes from temporal lobes. It plays a major role in control emotions like lusts, desires, cravings, pride e.t.c. it connect sensory signals from the environment, it play a major role in psychiatric disorders like , mood,post-traumatic stress and panic.

You might be interested in

Will anyone do research on Cookies and Cookie sheets and not plagarise (U can look at websites just do it in your own words and

hram777 [196]

Hey can u break it down and give me some more info on the exact thing u have t right about i will do it for you...:)

6 0

3 years ago

Based on the picture above, if someone has two X chromosomes, they would genetically be considered

ivann1987 [24]

Women have XX chromosomes and Men have XY
BLANK 1: Male
BLANK 2: Female

5 0

3 years ago

Certain substances pass from the blood in the glomerular capillaries into the ultrafiltrate under normal circumstances. Other su

mafiozo [28]

Normal:
Glucose
Rbc
NaCl
Amino acid
Plasma

Abnormal:
Albumin (protein)
Wbc

Remember that only small molecules can pass from the blood in the glomerular capillaries and this is cause they have thin walls

6 0

3 years ago

Plant cells make their own food from the reaction between which two substances?

Kipish [7]

What are the two substances?

8 0

3 years ago

Read 2 more answers

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago