1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
geniusboy [140]
3 years ago
12

Which phrase listed below best describes the function of the digestive system?

Biology
1 answer:
erica [24]3 years ago
7 0


C is the correct answer. The main function of the digestive system is to break down food into nutrients.

Food is needed to fuel the body for energy, and also for growth and repair. The digestive system converts the food we eat into their simplest forms , like glucose, amino acids and fatty acids. The broken down food is then absorbed into the bloodstream from the small intestine and the nutrients are carried to each cell of the body.

The large intestine  serves as a storage organ for the excretory products. However though this is true, the main function of the digestive system is to break down food into nutrients. The excretory duty is more of a necessity rather than a primary function.<span /><span /><span /><span />



You might be interested in
A drug company is testing the effectiveness of a new blood pressure medicine using rats as the test subjects
Yanka [14]

A constant factor could be the dose of the drugs  and the species of the rats used.

<h3>What is a constant factor?</h3>

In an experiment, a constant factor is one that is not allowed to change al through the experiment. This one must be held as the same and not allowed to vary. A constant factor could be the dose of the drugs  and the species of the rats used.

The factor that would be different for the experimental group and the control group  the administration of the new drug.

Learn more about experiment:brainly.com/question/11256472

#SPJ1

6 0
2 years ago
Cells formed by meiosis are
Leona [35]

Answer:

B. sex cells ( gametes )

Explanation:

These cells are our sex cells – sperm in males, eggs in females. During meiosis one cell? divides twice to form four daughter cells. These four daughter cells only have half the number of chromosomes? of the parent cell – they are haploid. Meiosis produces our sex cells or gametes? (eggs in females and sperm in males).

Hope this was helpful, Have a great day/night!!

4 0
3 years ago
Why is a hairy pet more work than a pet with short hair?
igomit [66]
Because the short hair animal doesnt have as much hair as the other.
6 0
3 years ago
Read 2 more answers
If sally goes on a typical weight-loss diet for women, how many kcalories will it provide per day?
Gre4nikov [31]
1500 calories, I believe
3 0
3 years ago
A diagram of the human digestive system is shown below.Removing which organ would have the smallest impact on digestion,absorpti
Whitepunk [10]

Answer:

The answer is esophagus.

Explanation:

The esophagus transfers food from the mouth to the stomach but isn't involved in digestion other than that.

3 0
3 years ago
Other questions:
  • PLEASE HURRY!
    8·2 answers
  • Animal cell have which of the following characteristics
    5·1 answer
  • The temporary storage of energy in ATP molecules is part of which process?
    12·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Years ago, scientists determined that all mitochondrial DNA in humans came from a common African ancestor. Based on this informa
    11·2 answers
  • According to the author, how has the almond tree
    6·1 answer
  • Can someone help with this question its due in 10 minutes
    10·1 answer
  • Plz i failed my biology test and its on taxonomy plz help me omg
    10·1 answer
  • Why does the grass look green under sunlight and black under the moonlight?
    14·1 answer
  • A. tipping fees (cost per ton to dispose of garbage at the landfill or waste-to-
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!