1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
7

Which of the following is NOT a function of the digestive system?

Biology
1 answer:
DaniilM [7]3 years ago
3 0

Explanation:

Deliver nutrients to the body cells.

You might be interested in
Why can't science prove something beyond a shadow of a doubt?
jarptica [38.1K]

Answer:

Scientific theories can never be proven true beyond all doubt; they can only be supported by a wide body of evidence. Only one of the statements that follow uses the term theory in its correct, scientific sense.

Explanation:

6 0
2 years ago
Read 2 more answers
Which of these organs is found in the excretory system?
Paraphin [41]

The urinary system is the main excretory system of the body after the gastrointestinal tract (large intestine) and lungs, In these questions it is necessary to prioritize the urinary tract.

The right answer is D. Bladder

The bladder belongs to the urinary excretory system.

The bladder receives the urine produced by the kidneys via the ureter and has the function of storing it before its elimination during urination through the urethra. The muscles surrounding the bladder help to prevent urine reflux to the ureter.


The right answer is C. Kidneys

The main purpose of the renal excretory system is to eliminate nitrogenous wastes while maintaining homeostasis, all through the formation of urine.

The kidney has a secretory function (filtration of blood in the glomeruli) and excretory from the pyelon (triangle based on the renal hilum) origin of the ureter. We speak of pyelo-ureteral junction. Each kidney contains about 1 million nephron.

8 0
3 years ago
Read 2 more answers
What is more stable a food chain or food web?
wolverine [178]
I believe that the food web is more stable

8 0
3 years ago
The ratio between the force of sliding friction and the normal force of an object is called _____.
Yuki888 [10]
The ratio between the force of sliding friction and the normal force of an object is called the coefficient of friction.


Hope this helped :)

4 0
3 years ago
Read 2 more answers
How do i complete this simple sugar fructose molecule ?
SVEN [57.7K]

Answer:

If you still need the answer here it is! good luck

7 0
3 years ago
Other questions:
  • How are species diversity and genetic diversity different? (1 point). - -Species diversity is evaluated only in ecosystems, whil
    14·2 answers
  • Sam looked at an image of an embryo that is a compact mass of cells. Which is the term for this embryo? A)gastrula B)zygote C)mo
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Help ASAP!!!
    7·2 answers
  • Which diagram represents binary fission?
    10·1 answer
  • Which action is most likely to stop succession and make an ecosystem less
    8·2 answers
  • Which processes are involved in metabolism?
    8·1 answer
  • True or false: Selective breeding has been used to produce crops with greater yields.
    8·1 answer
  • Please help will mark brainliest!!
    15·1 answer
  • Which of the following is the most POROUS? *
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!