1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikklg [1K]
3 years ago
8

What is the term used to describe the energy of moving particles

Biology
1 answer:
Finger [1]3 years ago
8 0

Answer:

Kinetic energy

Explanation:

Because the particles are moving, they have kinetic energy. The faster they move, the more kinetic energy they have. When an object is hot, the particles move faster.

You might be interested in
Which does not cause DNA mutations?
Nikolay [14]
C i am guessing but i hope this helps
4 0
3 years ago
Read 2 more answers
What is the amino acid sequence of the polypeptide produced by the “normal” DNA sequence in Model 1?
ruslelena [56]

The sequence of amino acid in polypeptide is dictated by the codons in the messenger RNA molecules from which polypeptide was translated. The sequence of codons in the mRNA was in turn dictated by the sequence of codons in the DNA from which the mRNA was transcribed. The amino acids are linked covalently by peptide bonds.

7 0
3 years ago
During the day, plants produce
Gekata [30.6K]

Answer:

During the day, plants produce (oxygen) by splitting water molecules in the light-dependent reactions of photosynthesis. At the same time, plants use cellular respiration to produce some of the (carbon dioxide) needed by the light-independent reactions to make sugars. During the night, plants produce (carbon dioxide, but not oxygen) because (only cellular respiration) takes place.

Explanation:

I will try to explain you, why is this the correct answer. During the night, there is only cellular respiration. Let me give you equation to understand the concept better. The equation of cellular respiration is: C₆H₁₂O₆ + 6O₂ + 6H₂O -> 6CO₂ + 12H₂O + ATP (energy) .. During the cellular respiration, the organism is making carbon dioxide, water and energy from glucose and oxygen. The plants are using oxygen during the night and making carbon dioxide.

I hope I helped you. I will be really happy, If you mark my question as brainliest.

8 0
3 years ago
What are all the steps in a descriptive investigation?
I am Lyosha [343]

Explanation:

Make an observation about a phenomenon (qualitative and/or quantitative)

Ask a research question.

Hypothesize a possible answer for your question.

Create a procedure to test your hypothesis.

Identify what you are testing.

Identify your control group/experimental group.

7 0
3 years ago
When quitting smoking, stress-management techniques can?
jekas [21]
Help ease people through the withdrawal process.
3 0
3 years ago
Other questions:
  • "blood vessels visible in the posterior view" of the heart include the
    9·1 answer
  • Women are more likely to be diagnosed with anxiety disorders because they are more
    9·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • The gases that make up earth’s atmosphere are commonly referred to as air. approximately what percentage of air is made up of ga
    12·1 answer
  • The process by which water crosses a selectively permeable membrane is called
    13·1 answer
  • 4) The biodiversity in an area is
    12·1 answer
  • What property of water makes water so helpful in riding the body of wastes?
    14·1 answer
  • Answer plz if u can I need help​
    8·1 answer
  • Define bisexual flower<br>​
    12·2 answers
  • 7)When a body cell divides through the process of mitosis, the chromosomes in the daughter cells *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!