1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

How does catalyst work

Biology
2 answers:
Aleks04 [339]3 years ago
7 0
A catalyst works by providing a convenient surface that
enables a different route for a chemical reaction to occur.
scoray [572]3 years ago
4 0
The activation energies of both these steps is lower than the activation energy without the presence of a catalyst, therefore more molecules will have the energy to react using the catalyst; hence the rate of reaction is increased. Take for instance the reaction between ozone and oxygen free radicals to form di-oxygen.
You might be interested in
What is the definition of a homologus structure​
Pavlova-9 [17]
Organs or skeletal elements of animals and organisms
3 0
3 years ago
A synthetic toxin destroys the myelin covering your optic nerves and motor neurons. what effect will the destruction of myelin s
Marizza181 [45]
Myelin sheaths, which cover the axon of the nerve cells in the brain and spinal
cord, prevents the electric current from dissipating from the axon.
 Destroying the <span>myelin sheaths impairs the conduction of signals on the affected nerves, causing damage in every function that the nerve is involved, in this case will affect movements and vision.</span>


8 0
3 years ago
During a flood, many individuals in a population of gophers drowned. Which effect of an environmental change does this best illu
yan [13]
During a flood, many individuals in a population of gophers drowned. Which effect of an environmental change does this best <span>illustrate? The answer is DEATH</span>
5 0
2 years ago
Read 2 more answers
A complex, unlearned, and fixed pattern of behavior common to all members of a species is called:
lina2011 [118]
The answer is:  an "instinct" .
______________________________________________
8 0
3 years ago
Extreme range temperatures can shatter rocks in deserts environment. Help me out please
Musya8 [376]
I believe it’s | Weathering |


How you know:

The damage was done by temperature, which has to do with weather.

Erosion is usually caused overtime by water elements , and it causes the rocks to erode.

Answer: weathering
8 0
3 years ago
Other questions:
  • Extracting aluminum from ore takes 20 times more _____ than obtaining it from _____ sources
    7·1 answer
  • How do viruses cause disease?
    15·2 answers
  • Pls help!!!!!Provide a possible solution to reduce the damaging effects of an El Niño or La Niña event.
    7·2 answers
  • What is non living or not produced by living things
    5·1 answer
  • An earthquake is the saking and trembling that results from movment of rock benath earths surface earthquakes most commonlz occu
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • For a cell to produce a current, the electrodes of the cell must ____.​
    12·1 answer
  • Briefly describe what makes a fruit the fleshy variety or the dry variety.
    7·1 answer
  • 1. · Explain the origin of coal and name its various varieties.
    10·1 answer
  • Exposure to toxins can affect a cell's homeostasis and energy production. Cells exposed to toxins will most likely-
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!